Description :
From Genome Similarity Track
Location :
Scaffold_1531:199- 1836
Sequence
1637 bases(100 bases per row)
CACAATCAGGTCTGCCCCGGCTTGAGGTTTGCCATCTTGACCATCAGGAGCACGGTCTGTGTCGCCGGCCACATTgccacgtccaccaccacctaGAAGC
CGACCGCTGCCATGTCCATCTTCTCTACGGTCTGAATCGACGTGACCATCGCGTCGTCGTTACCACGTGGATAGTTTATATCGCAGGCCACTTCATATCT
TCCCCCACCGCAATGCCGACACTGCCACTTCCAGTTGCTGTGCCACCGACCACTGTCCCAACGTCTCCACCACTGCGAAGCCGTGCGTTGCCGCGGTCAG
CAGCATTGCGGGCGCCCACCAAAGTCGGCTACTTAAACCGCCGATTCGTACGAACGCGCTCGATAGCAACACTGCTGCATCAACTACAGCATACCGGCTT
GGTTTAACACTGCCGCAGCTGGCTCGGTCGGGGCCGATGATACCAGGAGCGAACTATCGCTAGCGTAGACACGTCATAGAACAATCTGGCGTGCTACGGC
AGGTTTCACCAAGGCCTCTGCATCGTCACTTCCAGGATCACGCCGTATCCGGGCTAGCTGCGAACCACGGCGAATGTTCCCTTTGTACGTGAAAAGTTGT
TGTTGGAGATAAAACCTGTGATATTTCTCCCAACAGATCCATGTGACGTGGGGGTACATCCTGGGCTAGACATCCGGACAATGAACTATACGACAAAGGC
AAACGCCGTGTATGTGGCAATAGCTGGTCAACTCTGTGGAATAACGGCCTTCCCACCGACACGATACAGCGCCGACGTTTCCGGTTTTTGTCAGCATAAA
TCTGCTTAGACGTGACAGAGGAACCCACCACCAGCGGACTTCCTTGACTTCGGTCCGATCGCACACTTGACGGGACATTTGCAACTGCAGCCTCTTCCAG
GTCATGTTGAACACCCATTCCAAATAACATGTGCCCTTCGCTGGGAGCATCCGCCCAACGACCGTTGATGAGTTCACTGACGAGCTCAGTCATAAATTCG
CGATGGGGATCGCGGGCGAATAAATCTGGCCTGGCGAGGCGAGGCGACGAGTCAAGTACGCATTAGCTCTAGCGACGTCTACCAACGCAAGCGCAAGGGT
TTTGTGCCATCTTTTAAAAGAATATCCATCAGCTATTGAAAATCGGCCTCGAATATGATCGAGACGGTCCACCCCTTGCATATTGTCATTATATGATCTG
ACACATGCTGGCGCCGAGAACTCCACGTCTTCGCTGCTAATTATGCGAGTGACAGTAGTTGCAGTCGAGGGATCTGCATTATATACCATGTTCACTGTGT
TCCCGTCACACCAAGATGCGACAACCATGCCGTGCTCCAATGAAACTGCCATTCGCAAATCACCGCGAGCACAATCGCCATGAACTTTGTCAATAATGGT
GTGTTCTGGGAAATGCTTGCTGTTGATTCGGATCGTCCCGCGCGAATACAACCCCTTGAtgcgcagctcttgcagTAGCTGAACTGAAGTATGATAGTTG
TCTATGTTCAGTACGCGGTTCGTTCCAAATAGTGGGCGAGCGACTTCAAGCACATGCTGTCTGATCTTAGAGACCTTCGTTGGGTCttcccgcagcagca
atgcttCCTCGATAGAAACCAAGTCCACCAGTCTATC