Description :
From Genome Similarity Track
Location :
Scaffold_2881:199- 1262
Transcript NameFunction/comments
Phypl_g15460Avr4-associated TDF-like protein

Sequence
1063 bases(100 bases per row)
CAAGGTTCGCTACTCTGCGTCCGAGCACCATTCATTCTGCACCCGTCGAAATCTTTGCTTCGACAACTCGAGTTTGCTCATCAAGCTACTAGCTCAGTCT
TAAATCTGACAGCAGCTAAGCATTCTTCACCAACCAGCATAAGCTAACTACATGGGCACGATCTGTCGCCATGGACAGCCTGTGCGATGCAGATACAAGC
CGTCTGACAACCCCTCCAGCAAGCGGCAGATCCATTCCGCGCCAATATATATGACAAGTAAGCACATCGACGCCCCGAGAGCTTTCGAGAAATGCGAGGA
AGGACCTCAACCCCCCGCGCCTTCCTCATGTGCGTGATGGTCCTCCTCGTGGCTCCAAATGTGTACATAATGTTGCTATCTCCTTCTGCCCATTCatcgc
gcgcagcttcttcctgcgAAAGCGCTGTGTCGACAGACATTAGTGAgagaagctgcagttgcCGACGTGCGGGGTGCTTCGCTAGAAGTCGTTGTCACTG
TACAAATGTGGCGCGAAAATGGATCAGGTATCACCTCTGCAGACCTCAAAACGTGGCCAATCTTTCTTAGCAGAACGGCGTTGTTTAAATCGTGCCTGAC
GGCGGATGCCATAAAGTGTGGGGGTGACCGCCAGATCTAACGGGCTTCGCTCCATAAATGACCACGTCTTATTTCGAAACAGTGACCAAATGGCGNCGAG
AGGGTGTATCTCGACGTCGTTTGCGCGGCTGGACGTTCGAGGTGTAAATCTTCGAATACACCTGACGTCGACAGCTCTAGTTACGAAACCTACGGGTCGA
TAGAATGCTCGGGCATAGTGCTCCATGAATGCCACTTCCTCAATTCCATCCATCTCAACAAGAAGCACGTACAGTACTCGAGTACTGTAGCTCCTGGTGT
CGATCATCTGGCAAGACCCGACCTCAGTTCATTTTCAGTTTTGCACGCCGCCGAGTACTCCAGTTTCCAGTGCCAAGCGCGCTATGAAGCTGTTCTCGCC
AATCACCGCTGCATTCGCCCTCCTTGCCGCAGGCTCTAGCGCCCTTACAGAGGAGACCAAAAC