Description :
From Genome Similarity Track
Location :
Scaffold_54:198993- 200803
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20866Hypothetical protein

Sequence
1810 bases(100 bases per row)
GGCGCGCAGATCTGGCTGCCGGACCCGGAGACTGTCTGGCGCATCGTCGAGATCGTCAAGTACCACGAGGAAGAGAAGGGCATGATCCTCACGGTCGTCG
GGCCGCGCGGCCAGGAGACGGTCGACATGCGCGACATTGGCGACCTCTACCGCGTCAACCCGCGCGTCGTGGACGACATGACGTCGCTCTACTACATCCA
CGAAGCGGGCATCCTCGAGAACCTCAACGTGCGCAGTCGCCTCGACAACCAGCGCCCGTACACGTTCATGGCCAACGTGCTCATCGCGGTCAACCCGCTC
CGGAAGGTCGTCGAGCCCCACATCAAGGACTACGTCAAGACGCAGATGGGCGACCGCCCGCCGCATCCGTACGCTGTCGCCGAGGTTGCGTTCCAGCAAA
TGTCGCTGCGGTCGCCGTCGCAGTGCCAGTCGATTGTCATCTCGGGCGAGTCGGGCGCGGGGAAGACCGAGACGTCCAAGATTGTACTGCGCTACATCAC
GACGCGCGAGCACATTCTGAGCTCGGACGTGGCGCCAATCTCGACCTCGAAGCTCTCGTCGCAGGAGCTCGACCGCCGGCTCTGGGACACGAACCCGATT
CTCGAGGCCTTTGGCAACGCCAAGACGCTCCGCAACCACAACTCGTCGCGCTTTGGTAAGTTCATGAAGCTCCAGTTCTCCGAGGTCGCGGGCAACCGGC
TGCACCTCATGGGCGCCTTCATCGAGACGTACCTCCTCGAGAAGTTCCGCGTCGTCGCGCAGATCCCGCACGAGCGCAACTTTCACATCTTTTACTTTCT
CCTTGCCGGCGCGTCCGACGAGCTCTCGGCCAAGCTCTCGCTCGGAAGCCCGAAAGACTTTTTCTACCTCAACCAGAGCGGCTGCGTGAGCGACCCCAAC
ATTGACGACGAGCTCCTCTTTGACGACGTCTGCAGCGCGCTCAAGACGGTGGGCGTCGACGCGGACAAGCAGCTCTCGGTCTGGACGCTCCTTGCGGGCA
TCTTGCACCTCGGCAACGTCGTGCTCGTCAACCGCGAGACGTCCGAGGGCGACTGCGCCGAGGTCTCGTCCAACACGACGCCGGCGCTCGCGACGTGCGC
GATGCACCTGGGCGTCGACGGCGCGCACCTCGAGCGCGTCATCACGCAGCGCGAGATCGAGACGCGCGGCGAGAAGTTTGTCATCAAGCGCAACGCCAAG
GAGGGTAGTTATGTGCGTGACGCGATCGTCAAGTCGATCTACCAGCACCTCTTCGACTGGATCGTCCAGCACATCAACGTGGCGCTCGGACACGGGCCGC
CGGAGCTGCCGTTCATTGGCGTCCTCGATATCTTTGGGTTCGAGTCGTTCGCCGTCAACGATTTCGAGCAGCTTTTGATCAACTACGCCAACGAAGCGCT
CCAAGCGACCTTCAACCAGCAGGTTTTTATCGCCGAGCAAGAGCTGTTTCTGCACGAAGGCATTGACGTCGGCAAGATCCAGTGGCCCGACAACCGCGAC
TGCATCGACTTGATTGCGGCCAAGCCCAACGGCATTCTCGCGCTCCTCGACGCCGAGGCGCGGACGCAGAAGCCGTCGGACGACAAGTGGAACGCGACCT
TGCACAAGACGCACGCGGGCCACGCGCACTTTCTTGCGCCGCACGAGAAGGACAAGAAGTTTGTGTTTCTCATCAAGCACTTTGCGACGATGGTGCCGTA
CACGATCGGCAACTTCATCGACAAGAACAACGACACGATTCCGAAGGACCTCGAAGACCTCGTGCTTTCGTCGACGTCGGCGCTCATGGCCCAGATCTAC
AAGGACGGCG