Description :
From Genome Similarity Track
Location :
contig_47:198966- 219772
Transcript NameFunction/comments
g9209.t1XP_009523290.1 hypothetical protein PHYSODRAFT_496419 [Phytophthora sojae
g9210.t1hypothetical protein
g9211.t1hypothetical protein
g9212.t1hypothetical protein
g9213.t1XP_009523294.1 hypothetical protein PHYSODRAFT_313186 [Phytophthora sojae
g9214.t1XP_009523296.1 hypothetical protein PHYSODRAFT_488938 [Phytophthora sojae
g9215.t1hypothetical protein
g9216.t1hypothetical protein
g9217.t1XP_008890354.1 hypothetical protein PPTG_00670 [Phytophthora parasitica INRA-310

Sequence
20806 bases(100 bases per row)
TAATGAACGCGAAGAGCGCTGCACTGGCGGAGGCGTTGGTGCCGGCCACGTACGTGCAGCAGGGACTGGATGCTGTACGCGGGCGGGAGAAGCTGGTGAT
GACGCTACTTTCCCAGCGCCGCCTCCCGGACGACGGCTGGGACGACACCAGTGTGGAGCTGCTGCTGCACACGCTCTCGGCCATGGACAGCAACAATTTC
CGGGGCAGCGCCGGCGCCGGCGAGCGCGAGGCGCGCGTCTTCTCTGCGCTGGTGGCTCACCGCCATTTCAACTTGGCGCACGGCGTAGGCAGATCGGGTG
ACGTGGCGGCGGTGCAGCCCAAGGCCGCGGGGTCGTCTCTCATGGTGCAAGTGGCCAACGCCCTGGCCAGAGACGTGCTGCGTCTCGCTGGGATGCGTGC
GGTGCAGGCGGCGCTAGTGCTGCCAGTAGCCACGGGCATGTCGCTTATGCTGGTGTTGCAGCAACTCAAGGAGGCGAAGCCAATTGCGCGCTACGTCATT
TGGCCGCGGATCGACCAAAAGTCCTGCTTCAAGTCTATCCTGGCGGCAGGACTGACACCGCTGGTGTTGGCGAATATTTTGGTGGAGGAGGAAGGAAAGA
AACCAGGAGGATACTTGAAGACGGACCTGGCAGGCATGGCAGCACTCATGGATGAACATGGCAGTGACAGCATCGTGGCTGTGATGAGCACGACGAGCTG
CTTTGCGCCGCGCGCGTACGACAGTGTGCAGGATATTGCCAAGCTTTGTCAGGAACGCAACATTGGTACGGTACAAGTGGGTTGTGGATGCTGGGCTACT
AGCTGATGAAAGAAATTGCTGTGCTGGTTTATTGTTATGGTGTTGAAGCACATGTGATCAACAACGCGTATGGTGTTCAAGCATCCAAGTGCGTCCACCA
AGTGGAAGTAGCTATGCGCACAGGGCGTGTAGATGCCGTGGTGCAGAGTCTCGACAAGAATTTTATGGTCCCCGTAGGTGGAGCAATTGTCTGCTCAACA
TCGCGAGATGTTGTTGACCGCGTGGCGAAATTTTACCCGGGGCGAGCTAGTGCCACCCCTACGTTAGACTTCTTCATCACCATGCTTCAGATGGTAAGAT
TTACCCTCGTCTTTGGCTGCTCTCTAACATTATTTGTGTCTGGCTCATGAATCTATCAGGGGAGGAGCGGATATCGACGGCTTCTTGACGAGCGCAAGCA
GCTTGCAGCTTATATGCGCGAGCAGCTTGAAGCATTAGCAGCAGAGGAAGGCGAGCGCGTGCTACACGTCTTCAATAACGAGGTACGGGGATAGCGATTT
ACTTTCAGTTCATCGAGTTTGATAAGTCGGCCCGTTTCGTTCGTATGCACAGATATCCTTTGCGCTGACGCTAGGCACATTCTGCTCGAATGCCAAGGAT
CTGCAAGAGAAATCTCGGCAGCTTACGTCGCTTGGCGCAATGCTCTTTTCGCGTGGAGTGTCTGGTGCACGGTAAGTTCAAGACTAAGCTTAACGTTGAG
TTGGAATTGCTATCGGTCATCTGACGCATGCATTGCCTCAGAGTGGTGTCGTGTCTCGATAGCAAGACAATAGCTGGACACAACTTCAATTCATTTGGAG
CGCACCACGACGCATTTCCCGTGGCCTACGTTACTTTTGCCTGCGCGTTAGGCATGCAACAAAACGAGGTCGATCTGCTCGTCACGAAACTGCGCAAGAC
GATCCACGAGTGGAGAGCGAAGCAGAGCAGGTCGATGGCTGCCGTATAACGTCGCCACTCACCTCAAGTACATGTAGTTCAGCACTGGAGAACGGAAAGC
AGTCAAAATGTTGACTACTGTGTCTATAAATCTGTTTCCTGACGTGCTATCTTTTCCTATTCCTCTCTCCTTTCACTAACACAGCAGTCGCACTGAATTG
CCTAGTGCTTCTTACTGCCGCTCTTCGTCTTCCGAGTTTTTTTCTTGGCCGCAGGCGGGGATCCTGCCTGTTGGTCAGCCTCCGTCTTGAACTCAAGCTC
TCCAAGCAACTCGTTGGCAATGGCATCAGCAGCCGCAGCGGCATCCCCTTCACGGCGGCCCTTCGCGCCCTCCACAGCCTTCTCAGTGAATGCAGCCATA
AACTTGGCCGAATCGATCACACGCGGATCTTCCTCACCGTATGCCTCCTTGAAGAGCGAGTACACCTTCTTTTCGTACGTGAGGGCCTCGCGGAAGCCAC
CGGCAAGTCCACAAGCCATAGCCATCTGGTGGAGAACATTCGCAGCCTGGTTGCGGTCAAGCTCGCCGCGTCGGAGAGACTCGCGGTGGCACATCAGTGC
CAACGTGATCTGCCCCACATCTTGGCACATCATACCCATCTTAAAGTAGAGCGAGCTGATCTCAGGGAAGTGAGGTCCGCAACAGAACTCCAGCAGGTAA
ATGGCACGGCGAATGTGTGGCACCGCCAAATCCGTTTGGGCATTGGCGTGTAGGAATAACGCCACGTTGGCGTGTGCGAAGGCCGTGTCGTGGTAGTCGA
TGCCCTGAAGCTGTGTGTACAGAGCGAGCGCTCGCTGCTGCTGTGCGATAGCACCGACAACGTCGCCAGCGTGATAGAGGACAGTAGCGAGCGACGAGCT
GCAGAGAGCTGCATCCTCGTGGGCGGCACCACACACCTGGAAGAGCAGAGATGAAGCCTCCTGGAGGAACTCGTACGCACTCGACAGCGCTCCTTGGCCC
AAGTGCTGGCGACCACGCTCCAGGAGCTGCTTGGCCTGCGCGAACGGGTGCGCAGGCAGCGAGTGCTTCACGACCGGCACCACGCCAGTGATGTCATCCA
GGCTAATCGGCGTGGCGCACGACGATGAGAAGTCGTAGTTGCGGCTCACCACACGCAGCCCCAGACGCTGGCACAGACGTCGCAGCAAGACTATTCTGTG
CGCGCGGCCCACTGGAAAGGTGGCGTCATCAGCACTGGCCTCGCCACGGCCAGGACCCCACAGGGCCAACTTGTAGTCAAATCGGGCCTTAATCTCCTTG
TCAATGCGAGACCAAAGCGTGTTAGCATCCAACGACGCCGTCGTAGTAGCAGCGGCATCATCAGTCTCGAAGACATCCTTCTTGTCCGCAACAGCAGAAG
TCGATCCAAGAATGCCGTTCAGGAGCTTCACAATCGCCGATCCTGGGGCAGCACGAATGGAGTCGTTGGAGTTCAGAACATCAGCCAGGATGTGTTTGGC
AGCGCGAGATATCATTTCCACCTCGAGCACTTCCAGAAAGTACTTGGAGATACCGCCAATCGCCTCCAGCTTCTTGGCAAGCAAGCCAGACGACCCAGGT
AACGCATATTGATGCCGCAAGAGTGCATCAGCTGCGTGAGCGAGTAGCCATCGCAGGGGCGATAGCGCCACGGCGCACGTCGGCTACAAACGCTGGCACA
ACAATCCTCTGCAGATACTCAGCAGCATCTTTCGCCGCTGTTTCATCTGCCTCGAGCTGCTCCGCATTCGTTGAAGCCGCATAATCCATGAAGACGTTCG
GGTTCAAGAGCACCGGAGGAACCGCAGCCGTCTCCTCTTCCTCATCGGCCTCCTCAGTCTCCTTCTTCTCGGACGTAGCATCTTCCTTCTTCTCAGTGTC
AGCCTCAGCACCATTCTCCTTATTCTCATTTGCTTCCTCCGCCTTCTTCGCTTCCTTTGCTGCAATGCGAGCCTCACGGTTGACACGGCGGGCTTGGTTC
TGTTTCCAAAGCGAGTACAACTGGACCAGTTCCGGGCGCAGCAGAGCCGCGTAGCCTTCGTCGTTGCGAGTGAAGCACAATCCATCTTCTTCGGACGGAA
TAGACTTCTCCTCCTGTTTCTTTAGTGCAGTGTCGCGGCTCTTATAAAATGTCCAATCCTTCGGCGTGATGCGGACCAGATCCAGGACATACAGACGGCC
ATCAGAGCCCTGGATACCCTTGGCCTCCACAGCACCACAGATGGTTGCCACATCGGTGCTTGCCTCACCACCGCTACCAGGTGCAACACCAAGAGCCTCC
TGTTCCTTCTCAACGGCCAGGTCTTCTTCGGTCTTACCAAGAGGCTTAATGCTACGCTCTGCAATGTGCAGCTTCTCGCCCGCCTCGAGCATGAGCTTGT
GCATCTTGTTGTTGGCAGCAATGGTCTTTCCGTGGTCCACAGAGCCGTACACCAGCTTAGAAGCTGCATCTCCCATCAGGATGCCCGGGATAAGACTCTG
GGCAATAACACGGACACCAAGGTAGTCCACAACCGTCGTTGCCAGGGTGTGGAGACCACGGACATCCGCCTCGTTGAACGCCTTCACACCTTGCAGGTCT
CGGTTGGCAGCCGAGTAGGCGTTCTCCTCTCCTCCAGCGGCATCTTTGGTGGAGTTGCCGTCGATCGACGTCGAGAAGAAAATGTTGTTGAAAACGTATA
CGTGCGCACTCTTGTCGTCCATGGGGTTGATAGGAGGAATGTGTCCCTCAACGATAGCAACCGAGCCCTGGGTTGCTGCTTCCACGAACTCCGTCACAAT
CTTGTACATGACACGAGCGCGCACAATTTCGTCCTTCAGCGAGTCGGTCGACAGCTCACGGCAGCATTGATACTCCTCGTTCCAGTCACGCAGCACGCCA
CGCTCATCCATGCCGAAGGACGCGCAAAGTTCGTCTTCAGCGCGATTGAGGTCGTACGTGTGCTCCTCAGTCGCCGTGGCAGCAGGGGTGTTCCACGGCA
GCTTGCCACCCAAGCTTGATCCAGCCGCCACCATCCACTCGATAGAAGAAGGCCCCTCCTTCGCCAGAGAAGCAGCCTTAGCAAGGAGAGCAGCGTACGA
CTCCCTGAACTTCGGCGATACGGAGCTCAACACATCCACCAGCAGATGCGCGTGGGCCGCAGCGGTCTTGTGCGGACGCGGGTCGAACTTGGTGGCCGTC
GAGCGGTTCACAAAGAACCCATTGACGTGCGCCGTGATGTGGTAGCGCGTGTTATCGCCAGCAACCACCACCTCCAGGTAGAGCAAGTCACCCGCGAGTT
TGCGGGGTCCTGGCGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGACACAGGTAGGGAGTTTGGCATCCTGCTGCTTCTGCTCCGGCTCCTTGTGTTG
GTTGGCCTCGTTCTGCTTCTGCTTCAGCTGGTTCTTCTTCCCTTTCTTCGCCTTCTTCTGGTCCTTGGCCGGCGTTGGCTCCGCGTCCTCCTGCGCGACG
GGGGTTGGGAAGGCGTAGAACTCGGCGAGCTCGGGTTTCACTGGGACTTCGACCCCCTCGAGCTTGTGGTGGATCTCGCGCAGACGCTTGAGCTGCTTTT
CGGACATCTCCTTCAGCGCCTTGTCGTCCGGCTCCTCATTACTGGTATCGGCCACACCTTCCGGCTGAGCCTCGGGCTCCGTGGCTGCCTGGGGGATGGG
CGGATTGTTTAGCACGTCCCGGAAGCGACGCACATGGCCGCGCACCTTGCGGGCGTCGAACTTGTCCAGTGCCATGCGCAGCGTCACGCCGTCCGCCACA
CTCTCGTACTCGCCCAGCTCCACAAAGTCGTTGAGCGGCTGCCAGGAGCCGTCCGCCGAGCTCTTGGCCTCCAGGTGGTAGCTCGTGTAGCATGCGAGCG
CTGGGAACTCGGCGATGAGCTGGCGCAGAGACACGACCGTGTCCGAGGCCCCCACGCTTTCGAGCCGCACGCACTGGCCGCTCTTGGCGGCGGGAGGCGC
CACCAGCACACTGAAGGTTTGCTCTTCCAGGGCCAGGAGCTCTGCCGGCTGCTGCTCTGCCGGCTGCTCGACGGTGTCGCTGCTGCCCATGATGCGTGGA
ATCTGCTTGCTTTACGGGGCTGTCGTTGCGATCTGAGCAATTGTGTGGTGCGTGGGCAAGACCGAAAAGGCTGATGGACCATTGCAAAGGGGCAATGGCA
AGACAGTCATTTACCGAATTTGTTCAAGAATAAGTAGTGCCTCGTGCTGGTCCGATAGCAAATGTCAGTCAAACGGGTTTGACGGGTATGCTATATCAGA
GGCTTGAAGTTGTCTTTCATCTTCAGATTGTGGCAAATCACTTGGTGTTTGTAAGAGATCAGGCGAAGTACGTCATGTATCTGGCAGACGCACCGGAAAA
GCCCACCGAGAATGGAGAACATCTTGGCACTGGAGCTGTAACGAGCACCACGTCAAGCCACATCTGGGCACTGGAGCTGCAACGAGCACCCCGTCAAGCC
CGCATGCCTCCGTTCACCCAGCATGAACAGACTTTGCATCAACCACCAGCACCAGCGCTTTTGTACCAGTTTTGATGGATACGTTGGTGTGTGCCACACA
CAGACATGCTCATCCGAGCCCTTCGCCGCAGCTTCCTGGCGTCCGGACCTACCTCGTTGTCGCGTCGCTCACTTGCGCCCTTCACCTGCCGCACCATGAG
TTCCGATGAGCGCGCCCAGGCCGACGCTGCGGCCGCCTCGGGTGCTGCCTCCGCCGTGGGCGAGACCATCTTCGACAAGATCATCAACGGGCAGATCCCG
GCCAAGATCGCGTACGAAGACGCGCAGTGTCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCGTGCACATCCTGCTCATCCCCAAGAAGCGCGACGGCC
TCACGCAGCTCGCGCACGCCGAGGAGCGCCACGAAGCCGTGCTAGGCCACCTGCTGTACACTGCCAATCTGGTCGCCAAGCAGCAGAACCTGGACAAGGG
CTTCCGCATCGTCATCAACGATGGAGAGGACGGCTGCCAATCGGTCTTCCACCTGCACCTGCACCTTCTTGGGGACGCAAGCTGGGCTGGCCTCCTGGAT
AAACGAGGGCATCGGCCGCCGCCCTGTGTCAATGAGGGCCCATGGACCTCTGCGAATTATTCAGGTACAGGCGTGTATGTTTGAGGTAACCAATGCTACG
ATGCTGGCCTACTACGCGTAGTTACTTGGTCAACGTTATGGCGGTCTTTGAGGGCGCCACTTGGTTGTCTGGGCGGTCTATCCTCGGCCGCTGATCTCTT
TGAGGAATTGATCCAGGAACGTCTCCATGAACGCGTGGCGCTCTTCTGCCAAGCGCTTGCCGGCGTTGGTCTTCATCATGCCGCGGAGCTTCAGCAGTTT
CTGCAATGACAACAAAGTTCCCAGACGTTAGACAAGAGCACCACCGGAATCAGACAGCGACGTACCTCGTAAAAGTGGTTGATCGTGGTGTTGGGGCGGT
TCGGGTCCATGTACTGCTCCTTGGTCATGTCGTCAATTGGAGGCACATCCGGGTCGTACAGCGGCCGCAGCTTGTGCCCTCCGAACGTGAAGCACCGTGC
GATTCCAATGGCTCCAATCGCATCCTGCACGTCAGAAGCGGAAACGTTGTCAATCAGCACAAATGTCCGTTGCTGTTAGTGGACAGATAACCTACCAGTC
GGTCGGCATCCTGGACGCAGCCATATTCGATCGAGTACGATCGCTGGCAACACCAAGCAACGAACAGCATTAGCCACATGACTCCCATCCAACCAAACCA
TCGCCACTCAAAAGGTAGCATACCGAGCCGCTGCCAGCCAGCTCCTCCTTGAACCCCATGCTGTCAATGATAGTCATCACGCGCTCAATCTTGTCGCGGG
GCACGCTCTCCGACTGCAAGAAAGCCACCGCGCGCTTCGTGGGCTTGTCCTTGTCGCTCTGGTATTTCCAGTCGTCGATATCGTGCAGCAGCGCCGCCAA
GTCCACGATCTCCAGACTCTCCGCTGGCACTCGCTGTGTGGCACATGATGCACCCGTCAGCAACAGTCACGCGCTCCCAATCCTCCGCTGCAGCAAACCT
CCTCCCTGGCCAGCGTCCTCGCCACCGTCCACACGCGCTCGATGTGGCGCCAGTCGTGGGACGCGTCGTTGCTCTTGAGCTGCTGCTCCACGAACGCCGC
TGTGCGCTGCACCAATCGAGAGGTAGCCATCCTGGTCCGAGGCAAATTGCGCAATGAACAAGACAAAGCACAACCATCAGCTGTCGTACAGCGCCGCCAC
TTGGGGTTCGAGTTGCTGCTGCTTGGCGCGAACATTGCTCGTCTCTGATTGGCTAACTCGCACACCTTCAACATTGAAACTCCCCGCAGTTCCCCAAGAG
GCAGCACCATGAGCAGCTCCCGTAGCCGGGGCCCGACCCATGCGGCGGTGACCGCCAAGAGCGAGCGGCCCCGCAAGATCACGGCCAAGGCGGACGAGCT
GGACGCTTACATGGAGAAGCTCTACGACGACGACGTCGAGTCTAAGCTGGACGGGGCCAAGATGATTCTGCAGCTGGCCGAGTTCGCCGGCAACATCGAG
GCACTCGTGCAGAACGAGTCGCTCATGGTGCGTTCGGGTGGGAATAGCGTACTAGTTGCGCTGCTGATTGCTGTGTTGTTGCTTAGAGCCTGCTGTCGCG
CGTTCTGAACGACGACTACAAGAAGAGCTATGACTTTTCGCTTACCATGATGCGCATCTTCTGGTGCTTCTCCAACTTCTTGCAGCTGCATCCAGTGCTG
GGCAACTACCGCATCGGAGCCATCACACTCAAGATCGTCGAATTCGAGCTCAAGCGCCACCAGCTCCGGCAAGAAGAGGAGAAACTTCTCGAGAGTGCAG
TCAACGGAGCCCCAACAAAGGGAGAATCAACCGACGGCATCCTAGCGAAACTAGACCGCGAGAAGAAACGCAACAAGAAGCGTATGAAGAAACAGGACCA
ACTACTGTGAGAATCCTTCGATGGCAGCGGGATATTTGTGACTGACTCGAAAATTCGTTCTTGTAGCAATGTTTGCTTCAGCGTGTTGCTCAACTTGGCC
GAGGACATTCACACGGAGCGCAAAATGGTCAAGCGCAAGATTGTGTTTTTCCTGACCAAGGTTCGTGTCTGTATTTAAGCTGCTGGCCGGCTTGGATGTC
AAACGTTTGTAACTTACATGGTTTATTTGCTGCGTAGCTGCTGGATCGCGTGGCTCCTGACTTGGTTATCCTTACGATCACTTTCCTCAAGAAGCTGAGC
ATTTTTGAGGAGAACAAGGACGCAATGGTGGAGCTTACCGTCGTGGAGAAACTCGTTCGCTATCTCAACTGCAACCACGACAAAACAATCCAGACGGCAC
TCAAGCTGCTGTTTAACCTTTCTTTCGATCCAGCTATCCGTGAAGTGCTGGTGCGGAATAGCCTTATTCCAAAACTTGTGGAGCTACTCAAGAAACCTCC
CTTTCGTGCATTGTCACTGCGGATTCTCTATCACCTAAGTATCGATGATCGATGCAAGTCCATGTTCACGTACACGGAGGCTATCCCGATTGTCATGCAA
CTCGTGATAAATTTTCCGCAGAACATCGTGGCAAAAGAGCTGGCTGCTCTGGCGGTGAACCTCAGCCACAATGCGCGCAACGCCGAGCTCATGTGCCAGA
ACCGCGGTCTAGAAGCACTTGCAACACGCGTGTTCCGCACGCGTGACCCGCTCCTGATGAAGGTGATCCGAAACATTTCACTTTGGTCATATACGCTACA
AGAAGACTTGGTCAGCGATAAGGCGTATAAGTACCGTGGTATGTGGGCTCCATTCGTGGTTCCGTTAATCGAGCTGTGTATCAACACCGACAACCACGAC
TTTTCGATCGAAGTTCTGGCAACGCTAGCCAACATGACACCTAGTGATTTGCCTCCAAAGACATCATGGACAAATTGGTGACGGATCAATCGTTAATCCC
TTTCCTCAACAAAATGCTGGTGCCAGGCTTTTCGCAAGACGATATGATTCTTGAAGTCGTGCTTTTCGTTAGTGCACTCGCGCTGGAACCGAAGTGTGCT
CCTCTCTTATCGTCATCTCGGCTGGTTCGCACGTTCCACTCGCTGTTCCAAGAGAAGCAACACGATAACGAGCTCACATTGCAGTTGCTTTACGCGTTCT
ACCGCATGCTTCGCCACCCCGAAACCTTTGAGGAAATTCTCTTTGGAGTAGGGTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCATCAAACATTGAAGT
CCGCCGGATGTGCGACGTGCTCATGGACTTGATTCTCGACCACGATCTCAATGACGGTGCCATCGGCGACTTTGGACACCTCATTCGGCAACGCAGGTTT
GAAATCCACAACGCTGAGTATCTCGAAATGATCCATGCAGAAGCACAAAATGCAAGCTACCGCAAGCACCACGGAATGGATGACAATGGTGGCAAGGAGG
ACGACGATGACAACTAAGCGGCCAGAGTATCATCATCCGGAACCAGTCCAACTCATTAAAAGACCGCGTATACTTCTGTAGCCAGACTTAAACCTTTAAT
CCTTGCGGTAAACTGTTCCACGCAGTATTCTTGCCTGCAACGATCCTACTTCACAAACTCAACTAATCCTTTTCCTCGTCAGGAACCCAACCACGCTCTT
CCGGTCAATGCCAAAGCGAGGCAGTGCCTTTTCCGGCCAATACGTATTGTCCTCGCTGTTAATGGACGCCCCCGGTGGAATCACGTACATGCTGTACGGA
CAATTTGGTGATATGGTCATTGCAAGCGCGCGAGAGTTGTGTTTCCTTTTGTCCGAGTAGCGAACGAGTTGCCGCACGAATTTCCAATGGTCATACGCCG
ACTCTAGACAAAAAAATGTCATAGCCGATTCATGGAGATTACGCACTTCTGTCTCCAGTCTTTCCATCCCGACAGTTCCTCGCTGCGTCACCACTATACT
TGGGCTCTCGGGAAATGCTTCAGGGATCATTCCGTCTCGCGTACGGCACCAGAAGGCATCCACGCGAAACTCATGGTAAGTGTTGGTATCGGATGCGTCC
TGAATCTGGATACAGCATGACCAAGCGACGGAGTTCCGGATCATTGGATTGTCGATCTCCATCTTTTGATCTTCTCCCTCGGGAAGCTTTGAATCAAGGC
CACAATCAATCAAATCAATGAAAAACTGTGCTGCTCTCCACTCAGCCAAGCGACGGGCCTCCGCTTCTGTTTTCCATGTAGCTCTACAGAGAGCATGGCC
ATCGACTCGAACGACACAGTGCACACCAGGGGGTGAGCGAGAATCTCTGCCAAACGAAGCACGAGGAGGATCTTCCACAGCAGTTGTTATCTGTTGCGAA
GCACACTTACGGTTAGTTCGAACGAGTAGCATTCATAGCGAAGAAATACACGTACACTGGCGATGCCTGACAGCTTTAGAGCTCGAAAGGAATCCTCAGA
TGAAACATAGGCCAGAGATTTCACGTCCAGAAAATGAAGAAGTTGAGCCCAGATCGAGCGGATCCTGTTTAGCCTGTCCAACATGCCATCGACAGCAGCA
TTACAAGCTTCAGGCTTCGCCATTTTCGATGCTTTGAAGCGGATGACGTCGTTGACATCAACAAGAACTTCAAATACGCCTTCTCGCAGGCGTTCCATGC
TGATATTTGCCGTGACATTGGGGACAATTCTTCTGTGTTCAGCCCCCCGGTACTTCAGCGATGCTCGAAGTCTGTTAATACCAGCGCATAATTCATCTGT
TGGTGTAAACAGACTTCGAATTGCGGCGCGAAATTTGCCATCGTCGGTGTTCTCGCTCTCAGACACCTCATTATAGTTTTTTTTCATTTCATTCTCAAAG
GCTGCCTCATCTGCTGCAGCGCTGACATCTTGTGAGGCTTTGACTGCGGACGGATCCCAGTCATCATCAAATCCACCGTCTGAATAGTTATCGTAGTCGT
CGTCGTCCATCTCATCGTCGCTGCACAATACGAGATTAGACTTCTTCACTTGAGTTGTTGTCGGGGGGCGAGATTGGTTGGTTCCTGTGGATGTCGATGC
TGGTGCTGCATTTGCTGTGTTGTTGCTTCCATTTGAGGGGCACGACGGGGTAGATAAGGATATCATCTTGTTCAATGATTGCAGGATGTCGCGCCATTTT
TCATTTGCAGACCGTTTGGCATCTTTCGCGTTCAGGCATGCTGTCGAAATGGCCAGTGTGTTGCGCACTCGAATGAAATACATGTACAAGGGCGGAACGA
GCTTTTCCGACGCCGAAACCTGAAAGGACCTTGTGTTAGTCTCCCTTAGGGCCAACAATGCAGTACTTCGAAGTAGTTAGCCAGCCGTACCTTGTCATGA
TTCTTTGCTTGCGTTTCGTTGCCTGCCATCAAAGTTGTGGGCGTTTCAATTAGTCGTTCGTTGTACGTGACGAGCAACGCTTTCCACGTTTCAATCATCC
CATCCAGTGTGTTTATCAAAACAGAAATTGCCTTGTCCTTCGCGATTTCAATCGACGACCCTTCTCCTTTTGCTTCGACCACGCCTTCGGATGCAGAAAG
CACACAGCTAACAAGACCACTGTTTTCCTTCGTAGCAATCCGGCGGATCTGGAATGCAATGTAGACATCACACTAAGTAAAACGTACTAAACTATACGAA
GCAGGAAAAATACCTTCCGATACATACCGATAGATTGGACGAAAGCTGAATAGTTTCGGACTGCACACGCAAATTCCACACGATCGATCTTACAGTTTGC
TCGGTCCTCTCCCGATCTCGAAATAGGAACATCAGAAGTTCCTGGTAAGCGTCAGATTTTGCTTTTGAGGCTTCATCTTCGGAACGAGGGGGTCCATCAC
TATTGGCCTGCGAGCCGCTTCGATCTTCAATGAAGATGTTTGCTTCTGCTTCGGCACCAGAGATTCTCTCAGCTCTGTTTTCGGAATATTTCCTTTCAGG
AAGTGGTGGTATTTCGGATTCTGGGGCTGAGTACTCCAGTCGGGGACGAGGAGCACCACGCTCGTCCTCGTAAGTGTCATTTGCATTTGGTGCGTAGTGT
CGCTTTCGTAAAATGCCCATAGACCTTAGCTCAGCATCTCTCGAGCCGACATTTTCGCTGCTCACGCTGTTTTCGCGCATGGAATCCACCTCGCTGTGGT
TATAATATGGCTGGGCATCTTCAGTCGCGCTTGGCTCATAACTGCTGGTCCACGCATCTCCATGGTGGGGTTGAACACTTTCTATCTTGGTCGGTTCAAA
GTCGTTCACATGGTGCTCTGCGCGGTCGAGCATCAGACTCTCCTCGTGCTGATCAATTAATTCCATCAGGAACAGCATCAGTGCGTCAACTGTCTCACTT
TTAACGCTGGGTAAAGATGAACCACGCCTCCAAACGAGTGGGAGCTCTTGGATTAGAGCAACTACGTCATAGTTAGTATCGTTATCAGTGGGCTCTGCAG
TGGGTTTCTCGTACAGCTGCACAATCCAATAACTTATCAGTCTAATATCAACATGCCAGCCAAGCAAATGTGCGTACCCGAACAATTTTCTTCGAGATCA
GATAGTTGAAAGATGCATCTTTCACCCTTCTGGTATCATTCGCGATACAGAGGCCGAATTGAGACTTCAGATGCAGCAGCATGCCGCCATACAGTCTTCG
ATGTTCAACTACAGCCCTTGTAAGCTGCGACAAAGCTCGGATAGTTGCATCACGATCGACAGATGCAGTGCACTCAAATGACAAATTTCCTAGTCGAACC
CGAGCAATGTACTGGGCCGAATCAACCATCCGCAACTCTCGCCGAAGCTGCGCGGAAACAACCGTCAACCAAAGTATTCAGGGAATGAGGAAAACAGAGA
GCTTACCTTGAGTCCCGCAGCCAAGATAAACTCTTTACTCATTGCTGACAGCGACACAGTTTGGACAGCTTTTCCTAGTCCTTGAAGCGATGACACGAGG
TCGATATTAGGGCCAACCAAAGCAAGGAGGTACGATCGGCCCTCCTCAACACCGAAAGTTCTCTGCTTGGCGGGGATACTTTTGTCACTCTGTTGGCCCT
GCTGAGTGGGTGGAGGAGGTAGAGGTGCTGGAGTCGGCGTCGGAGCTGAAGCTCTAGCGGCCTCAGAGACTGGCTCAGTCACGCTTACATGGATCGGCGC
GGCATCTATAGCAAAAGTCACCCGTTTCTTCGGCGCAGTCCGTGCGGCAAATTGAGAACCTTTGTGGCGCAGTATCGACGTAGTGCTCGGTGCACCGGCA
GGGTTGCTGTCATAGCTCTCGTCGATCGTATCGACTGCCATGTCCACAGGTTCCTCAGCCATGTCCACGTCCTTGTCTTGTCCTTGTTTGCTCCGTTGCC
CACCCCCTGCTCACGCATCAATTCCGCATACCACTTCCGGAATTTGTCGGCGAATTGGAACTTCCTGTCCTCCATCAACGTGTTCCTCATGTCTCCCGTC
ATGATCTTCACGTACATCAGCAGCTTCTTGGCCGAGTGTATGCGCTGCACTGCCACTCGGTCCTGTCTGATCAGCCCCTCGTAGCGTTCAGCCAACTGCT
GGTGGTGCGTGTCCATCTCGTCCAGGAGGCGGAGAACGCGACCAGGCGTGCGTCCCTGTCTCGGATCGTCCCGAGCCGCCGCCCCCATGCGTACGAAGCG
CAGCACAACCGTCCTCCTCGTCGCCTTGTCCTGCTCCTGCTTAATGTGAACTTGTGCCCCAATAGCAGCCACGTCCTTATGCAGCTGCTTGAGTTTCCTG
GGGCACAAGAGGAAGTCCTCGATGCCCATTCCCACGAAATAGTCGTCCGGTTCCACGGTGCAGATGGGCTCCAGGGCAGCGCATTTGCCCGCCACTTTGT
CCTCGAACGCCATGGGAAACTGCGGCGGCGCTGTCTTCTGCACTTGGAACAGGTGCGAGCTCATGATGGCGGTCACTGACACGCCCATGCTCGCGAGCTG
CAGGTCGCCAACGGGCCCACGGGGAAGCGAGTAGTGCACCTCGAAGGCGCGGCCTAGTGACAGCAGCTTGCGAGCAGCGAGCGTCGTCTCCACGCGCCAC
AGACGCACGCTCATGTCGAACGCCAGGTCTTGGTTGAGCTCGGGAAGCGGCTCCATGCTGTCCGCCCAGGGCGCCATGTTCCAGGCTCTGCCGACAACTG
GATGTCACTGTGTGTGGCACTACGGAATGACTGGATTTCACTATACCAGTTGGTGCCAAGAGGGACAATGCTCGCGGCTTGTGTGTGTATTACTTATGTT
AATACTGTCTACTCCATGAGGAAGATGCGGCTGGCAACGTCGCCGACGAGCCAGTCGATGCCGTCCACGAGGCCGTCGCCAGTGACGGCGCTGCACGAGA
CGATACTCCAGTGGCGGGTGGAAAACTGAGCCGACCGCAGCCCCAAAGCGTCTGCGATCTCCGCGGAGGAGAGAGCGCCAGGCAGGTCCTGCTTGTTGGC
AAAGATGAGCAGCGTAGCGCCTGCTAGTTTCTGCAAATACGGTAGCAGCCAGCAGTCAGAGAAGCAGCAACTTCAGGAGGATCTTATGAACGCACCTCTT
GCGTCAGCAGACTCGAGAGCTCGCGCTTGCAGTCTTCGAGTCGCCGTCGATCGGCGCTGTCCACGACCCACACGAGGCCATCCGTCTGTCGAAGCACACA
TCCACTGTAAGCTTCCTTTATACTTCAGTATATACAGCCTGCCGCTTCCAGACCTGCTCGAAGTAGTTTCTCCAGTACGAGCGAATCGTTTGCTGTCCGC
CGACGTCCCAGACATTCAACTTGAAGCTGGCAGTGACAGCAACACAGCGACCATGAACCTCGCACTTGCACAGAACCCACCGCGCACACTCACTCTTTGT
ACTCAAGTGTCTGGATGTCGAACCCCAGCGTTGGAGAGATCTCGGTGATGTCCTGGCCCATGAACTTCTTCAGGATTGTCGTCTTGCCGGCGTTGTCCAA
GCCACTACAGCAACAGCAAGCGCGTCAGCCCCAGTAAACGACCTCTAGCACTAAGAGTGAAGATAGCAACGCACAGCATAAGGACTCGGATCTCCTTCTC
CTTCTCCTTGACCTTCTTGAGGATACTCAGCAGCCCCATGATGCGATTCGCCTTGGTGATCTAAAGTAAATTGCCGAACGGGAAGTAATTTATTTGTAAA
CTACCGTCACGAAAGGGCATGAAACGACGCTTACGTTAGGTAGTTCAAGCGCAGCGCAATTGCAGTTAGTACTACGTAGTCGATACGCCATGACCAAGGC
CGCCCCACCTAGACGCTTACTGCTGAAGAAGTGCGATGGGAACCAGGAGGACGTAAACGCTTTCGATCCGAGCAGTCGGTCGACCAAGGCGCATTTCCCC
CTGCAACAGGAGCAGTCTTCAAAAGAAGATGCAGATCCGTTCGAGAGCAGAAGAGCTTGCAGACACACGTCATTGGAAGAGCTACTAGATCTGGAACTGG
ATTTGATCCTGCCTGTCACTGCAATTCCAGCTCCGACGAGCAACCAGTTGCCTGTTTGTGCTGCAAACGAGGAGCTGGAGGCCGACGTCGACTCCGTCTC
ACTGGAGCTGCTGGTACGAACGAGCGAGCAACCATAGTCGTAAATGACAACTCACATGACTCGTATGTGTTGATGATGCAGGCGATGCAGAGCCCACACG
GCGAAAATCAGCAATGGCTAAGCGAAGAAGACGAGCAAGACGCGAATTCCGTGCCAAGCGTGATCACCGTTCGACCAGAGGAACAGTCTCCACGGCCTAC
TGTGAAAAGAGCGTCGGCTTCTAGAAAACCGATGGCGCTTCATCTCGTGTCGCCGACAGCGTTTGTACCATCGTTCCCTCCATCACCGAGCCAGTCGTCG
ACAGACGAGGACTATGGTTTAGCATCGCCGATGGCGCTGCCAGACACACCTTCACAGTCTCAATCAGGGATCACTTTAACCTGGGACCTTGCACCAACCT
CTCCTACCTACGAAGATACTTATACAAGAGCAGGAACTTCTCGTGGATTCGCACAGTCCAAGAGCGTCCAAAGACCAGAGCGTCGAACCCCTCGATTTTC
AGCTGCAGCTAGAGCTGCAACACCAAACCCACGAAACCACGGAAGCTATGCACCGGACCGAGCTACGGCACGGATAACACGGTCTGCACTTCCAACGCTA
CCGGAAGGCCGAGGCAAGGCTAGGCATGGCGGAATCTACTCATTGTTACTCAAGAATAAATCTGGGAAACAGGAGCCGATGCTCGTTGAGGACGCACACA
ATTCCGACGGTACGCTGCTGTGGTTTGATGGTACAGAGGAAATTTTTGGTACTGATTTCTATCCCTCAGATATGACTCAGGCGCCTTCCGTTTCTAAGGC
GAGTGCGTGCAAGCAAAAACACGGAGGTATCTACAAAATGCTGAGAAATTATAAATAATTTCTCATGTTATACACGGTTCTCTCGTTTTCTCTCTTAACG
CTATCCATAGCTCGAGTTTCATTTCGTGCCGACCATCCTGGATTTTGTGGATACACATGTTACCCGGTAATTTACCCTGTAATCTATTCTTTTTTTGCTT
ATTGCATCATCAAGAGAAGAGCGCACCGAGATGAACCGCATTTTCGGCAAGAAGAAGGCCGAGGCACCCTCCGTCAACGTCTCCGATGTAGGGGGAAAGG
TGGACGCGCGGATCACCGACCTCGACATGAAGGTAAGTGGCTGGGACTTGCGCTGCGGCTAATGAGCGCCGCTGACCGAGTAAACCCCAGATAGAGAAAC
TGGATCAGGAGCTCCGGAAGCACCGGGAGCAGATGAAAAAGACGCGGGGCCCAGCGCTCAATACTGTGAAACAGCGAGCCATGCAGACACTCAAGCGGAA
GAAGATGTTCGAGGCGCAACGGGACAAACTGACAGCCCAGTCCTTCAATATTGAGCAGGTGCCTTGGACAGATTGACGGGCGTTGATGGGCGTCTGAGGC
TGGTACCGAACGCTGATCCTGTGCGTGTATGCTCCGCTATCGAACTCTCTGGATTGCAGGCCTCGTTTGCCATTGACACATCAAGGGACACAATCTCAAC
TGTGGCTGCCATGAAGAGCGCAGCGGTGCAACTGAAGGCAGAGACACAGAAAATCGACATTTCCGAGCTGGAGGTGAGACTGGCCACATTAACTATGTTG
CGTATAGCGAGCTATTTGCTGATGCGCCCTGTGCGATTATGCGTGGAGCAGGACGTGCAAGACGACATGGCGGATTTGATGGAGGATATGAACGAGATCC
AAGAGATCATGGGGCGCTCGTACGGGTACGTACTTGCAGCACCTTATCACTGCTTGCCTGAAGTCACAATGCGAGCATATCTGACCGTGTGATGTTCGGG
CATTTTTGCCTATCTGCAGCATCGGCGACGAAATCGACGAAGACGAGTTGGAAGCGGAGCTGGAGGGGCTGGAGGAAGAGTGGGCTGAGGAAGAGGCGCT
TGGAGAGGAAGCAGAGTCGGCGCCGTCGTACCTTGCACCAGCCCAGCACCACGAGCTGCCTGCCGCCCCCTCGGGCATCTTAGACTCGGGTACCACAGCT
CGCGCTACCGACGAGTTCGGGCTTCCCGTAGCGTCCTACTCTACGTAGCGCTGCAAGCTGCACACCCAGGAAAACACAAGACCTTACCAATACATTTGCA
GCACATTCGCAATACAGCCATGTGTCATTGCGCAGTTCGTGTCGCTGTCAGCCAAGCGTTGGATCGTGGCCACGCACTTGTCAAACATGGACCGGGAGAG
ATGGCTACATTATACCACGTCAGCGGAGCTACGCTATTGGCCGAGCTTAGACAGCCAATCATTTTTCGGAATCACGTTTGACAGGGTAAAAAATGAATAT
TACAGGATATGTATTATCACAAGGTGGTTATTGATGTATTTGTAAAGCAAGTGTATCTTTCCCTCGCACGAATTCGTTTATATCATTCGCGAGGTTTTTT
ATCCCCGAGGTTTTATCATTCCAAGCAAAATTTGGTTGCGCTCACTTTGGTATTGGTGGTTTTGGCAGCGCTTCGTCCAGATTCCAAGCAGCAGTCTCGC
AGGTATGGCCCGCGAAGCAAAGGAGCCGCGCGTGAAGCGCGAACGCAAGGGAAAGAAGGAGTCGCGCAAGAAAGCGGCCGAGGAGAAGAAGGCTGCCGAG
AAGGCCGAGGCGCTCGAGAACATGTCGCACGCCGACCGCTTGGCCGAGGAAGGCATCATCGCCACGTGCTCGCACAACGTGCGCTCGGTTCACAAGAACT
TCAAGGACATCAATGTGCTCAACTTCAGTATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTTCGGCCGGCGCTACGGCCT
CATCGGTCGCAACGGTTCGGGTAAGTCCACCTTCATGAACGTGCTAGGCGCGCGCGGTATCCCCATTCCGGAGAGCATCGACATCTACCACCTTAAGCAC
GAAATCGAGGCCAGTGACATGACGGCGCTCGAGGCCGTGCTCTCCGTGGACGAGGAGCGCAACAAGCTCCAGGCCGAAGCTGACGCTCTCTCGGAGAAGA
TGACCGACGATTCCATCAGCGAGGAAGACAGCGAGGCCATCTCTGACCGTCTGACGGACCTGTACGAGCGTCTCGATGACATGGACGCCGCTACGGCCGA
GGTCCGCGCTCGTCAGATTCTGTCGGGTTTGACGTTCTCGGACGCCATGATGGAGAAGAAGACTAAGGAGTTTTCCGGTGGGTGGCGTATGCGTATCGCG
CTCGCCCGTGCTCTGTTCATTCAGCCGACCCTGCTGCTGCTCGATGAGCCTACCAACCACTTGGATATGGAGGCTGTCGTCTGGCTGGAGGACTACCTGT
CCAAGTGGAAGAAGATCCTGCTCATGATTTCGCACTCACAGGAGTTTATGAACGAAGTCTGCACGAACATTATCGATCTCACCAACAAGAAGCTCGAGTA
CTACAATGGTAACTACGACACGTACGTGCGCACCAAGGCTGAAAAGGAGGAGAACCAGATGAAGCGTTACAACTGGGAGCAGGAACAGATCAAGCACATG
AAGGAGTACATTGCCAAGTTCGGTCACGGTTCCGCTAAGCTTGCCCGTCAGGCTCAGAGTAAGGAAAAGACGCTGGCCAAGATGGTGCGTGACGGTCTCA
CGGAGAAGGTCGAGCAAGAAATGATCGGTGACTTCAAGTTCCCCAACCCGGAACCGCTCCCTCCTCCGGTTCTCATGTTCCAGAATGTGGCTTTCGGTTA
CCCGGATTGCCCCCTGCTATACTCCGGCGTTGAGATGGGACTTGACCTGGATTCCCGTGTGGCTCTAGTCGGTGCCAATGGTACTGGTAAGACAACCCTT
CTCAAGCTTATCACAGGAGATCTGGTGGCGCGAGAGGGTAACGTCCGACCACACAGCAAACTTCGCATTGCGCGATTCAGCCAGCACTTTGTGGATGTGC
TGGACCTGACGAAGACCCCGCTTGAATACTTCCGCTCGCTCTTCCAGACGAAGTCTGTTGAGGATGTCCGTAGCTACCTCGGCCGCTACGGCATCACCGG
TGAGGTGCAAACACAGATCATGGGTCAGCTTTCTGACGGACAGAAGAGTCGTGTGGTGTTTGCGTACATGGCGCAGCAGAATGCACACATGCTGCTGCTG
GATGAGCCCACGAATCACTTGGATATGGAGTCTATTGATGCACTGGCTCGCGCTATTAACAACTTCGAGGGTGGCATGTTGCTGGTGAGTCACGACATGC
GATTGATTTCGCAGGTCGCCAAGGAGATTTGGCTTGTAGAGAACCAGTCTATCAAGGTCTACCAGGGTGAGATTTCCGACTTCAAGATGCGCGTGCGTAA
GCAGCTCAAATTGGCGGACAAGGAACCTGCCAAGGGTGCCGAGTAAATGCTCATGATAGCTTTCTTCTCATTAGATCACCTCTACATGTAGAGCTGTTGA
GGCAACCGCTGAAGCATTTTCTTAGCACGCTGTTCTGTTCATATTTGATTCCCTTGCCGACAGATAACATAGATTGAAAAATCACACGTTGGTAGTTGAT
GAAGTT