Description :
From Genome Similarity Track
Location :
contig_47:198949- 219758
Transcript NameFunction/comments
g9662.t1XP_009523290.1 hypothetical protein PHYSODRAFT_496419 [Phytophthora sojae
g9663.t1hypothetical protein
g9664.t1hypothetical protein
g9665.t1hypothetical protein
g9666.t1XP_009523294.1 hypothetical protein PHYSODRAFT_313186 [Phytophthora sojae
g9667.t1hypothetical protein
g9668.t1hypothetical protein
g9669.t1XP_008890354.1 hypothetical protein PPTG_00670 [Phytophthora parasitica INRA-310

Sequence
20809 bases(100 bases per row)
TAATGAACGCGAAGAGCGCTGCACTGGCGGAGGCGTTGGTGCCGGCCACGTACGTGCAGCAGGGACTGGATGCTGTACGCGGCCGGGAGAAGCTGGTGAT
GACGCTACTTTCCCAGCGCCGCCTCCCGGACGACGGCTGGGACGACACCAGTGTGGAGCTGCTGCTGCACACGCTCTCGGCCATGGACAGCAACAATTTC
CGGGGCAGCGCCGGCGCCGGCGAGCGCGAGGCGCGCGTCTTCTCTGCGCTGGTGGCTCACCGCCATTTCAACTTGGCGCACGGCGTAGGCAGATCGGGTG
ACGTGGCGGCGGTGCAGCCCAAGGCCGCGGGGTCGTCTCTCATGGTGCAAGTGGCCAACGCCCTGGCCAGAGACGTGCTGCGTCTCGCTGGGATGCGTGC
GGTGCAGGCGGCGCTAGTGCTGCCAGTAGCCACGGGCATGTCGCTTATGCTGGTGTTGCAGCAACTCAAGGAGGCGAAGCCAATTGCGCGCTACGTCATT
TGGCCGCGGATCGACCAAAAGTCCTGCTTCAAGTCTATCCTGGCGGCAGGACTGACACCGCTGGTGTTGGCGAATATTTTGGTGGAGGAGGAAGGAAAGA
AACCAGGAGGATACTTGAAGACGGACCTGGCAGGCATGGCAGCACTCATGGATGAACATGGCAGTGACAGCATCGTGGCTGTGATGAGCACGACGAGCTG
CTTTGCGCCGCGCGCGTACGACAGTGTGCAGGATATTGCCAAGCTTTGTCAGGAACGCAACATTGGTACGGTACAAGTGGGTTGTGGATGCTGGGCTACT
AGCTGATGAAAGAAATTGCTGTGCTGGTTTATTGTTATGGCGTTGAAGCACATGTGATCAACAACGCGTATGGTGTTCAAGCATCCAAGTGCGTCCACCA
AGTGGAAGTAGCTATGCGCACAGGGCGTGTAGATGCCGTGGTGCAGAGTCTCGACAAGAATTTTATGGTCCCCGTAGGTGGAGCAATTGTCTGCTCAACA
TCGCGAGATGTTGTTGACCGCGTGGCGAAATTTTACCCGGGGCGAGCTAGTGCCACCCCTACGTTAGACTTCTTCATCACCATGCTTCAGATGGTAAGAT
TTACCCTCGTCTTTGGCTGCTCTCTAACATTATTTGTGTCTGGCTCATGAATCTATCAGGGGAGGAGCGGATATCGACGGCTTCTTGACGAGCGCAAGCA
GCTTGCAGCTTATATGCGCGAGCAGCTTGAAGCATTAGCAGCAGAGGAAGGCGAGCGCGTGCTACACGTCTTCAATAACGAGGTACGGGGATAGCGATTT
ACTTTCAGTTCATCGAGTTTGATAAGTCGACCCGTTTCGTTCGTATGCACAGATATCCTTTGCGCTGACGCTAGGCACATTCTGCTCGAATGCCAAGGAT
CTGCAAGAGAAATCTCGGCAGCTTACGTCGCTTGGCGCAATGCTCTTTTCGCGTGGAGTGTCTGGTGCACGGTAAGTTCAAGACTAAGCTTAACGTTGAG
TTGGAATTGCTATCGGTCATCTGACGCATGCATTGCCTCAGAGTGGTGTCGTGTCTCGATAGCAAGACAATAGCTGGACACAACTTCAATTCATTTGGAG
CGCACCACGACGCATTTCCCGTGGCCTACGTTACTTTTGCCTGCGCGTTAGGCATGCAACAAAACGAGGTCGATCTGCTCGTCACGAAACTGCGCAAGAC
GATCCACGAGTGGAGAGCGAAGCAGAGCAGGTCAATGGCTGCCGTATAACGTCGCCACTCACCTCAAGTACATGTAGTTCAGCACTGGAGAACGGAAAGC
AGTCAAAATGTTGACTACTGTGTCTATAAATCTGTTTCCTGACGTGCTATCTTTTCCTATTCCTCTCTCCTTTCACTAACACAGCAGTCGCACTGAATTG
CCTAGTGCTTCTTACTGCCGCTCTTCGTCTTCCGAGTTTTTTTCTTGGCCGCAGGCGGGGATCCTGCCTGTTGGTCAGCCTCCGTCTTGAACTCAAGCTC
TCCAAGCAACTCGTTGGCAATGGCATCAGCAGCCGCAGCGGCATCCCCTTCACGGCGGCCCTTCGCGCCCTCCACAGCCTTCTCAGTGAATGCAGCCATA
AACTTGGCCGAATCGATCACACGCGGATCTTCCTCACCGTATGCCTCCTTGAAGAGCGAGTACACCTTCTTTTCGTACGTGAGGGCCTCGCGGAAGCCAC
CGGCAAGTCCACAAGCCATAGCCATCTGGTGGAGAACATTCGCAGCCTGGTTGCGGTCAAGCTCGCCGCGTCGGAGAGACTCGCGGTGGCACATCAGTGC
CAACGTGATCTGCCCCACATCTTGGCACATCATACCCATCTTAAAGTAGAGTGAGCTGATCTCAGGGAAGTGAGGTCCGCAACAGAACTCCAGCAGGTAA
ATGGCACGGCGAATGTGTGGCACCGCCAAATCCGTTTGGGCATTGGCGTGTAGGAATAACGCCACGTTGGCGTGTGCGAAGGCCGTGTCGTGGTAGTCGA
TGCCCTGAAGCTGTGTGTACAGAGCGAGCGCTCGCTGCTGCTGTGCGATAGCACCGACAACGTCGCCAGCGTGATAGAGGACAGTAGCGAGCGACGAGCT
GCAGAGAGCTGCATCCTCGTGGGCGGCACCACACACCTGGAAGAGCAGAGATGAAGCCTCCTGGAGGAACTCGTACGCACTCGACAGCGCTCCTTGGCCC
AAGTGCTGGCGGCCACGCTCAAGATGCTGCTTGGCCTGCGTCAACGGGTGCGCAGGTAGCGAGTGCTTCACGACCGGCACCACACCAGTGATGTCATCCA
GGCTAATCGGCGTGGCGCACGACGATGAGAAGTCGTAGTTGCGGCTCACCACACGCAGCCCCAGACGCTGGCACAGACGTCGCAGCAAGACTATTCTGTG
CGCGCGGCCCACTGGAAAGGTGGCGTCATCAGCACTGGCCTCGCCACGGCCAGGACCCCACAGGGCCAACTTGTAGTCAAATCGGGCCTTAATCTCCTTG
TCAATGCGAGACCAAAGCGTGTTAGCATCCAACGACGCCGTCGTAGTAGCAGCGGCATCATCAGTCTCGAAGACATCCTTCTTGTCCGCAACAGCAGAAG
TCGATCCAAGAATGCCGTTCAGGAGCTTCACAATCGCCGATCCTGGGGCAGCACGAATGGAGTCGTTGGAGTTCAGAACATCAGCCAGGATGTGCTTGGC
AACGCGAGATATCATTTCCACCTCGAGCACTTCCAGAAAGTACTTGGAGATACCGCCAATCGCCTCCAGCTTCTTGGCAAGCAAGCCAGACGACCCAGGT
AACGCATATTGATGCCGCAAGAGTGCATCAGCTGCGTGAGCGAGTAGCCATCGCAGGGGCGCTAGCGCCACGGCGCACGTCGGCTACAAACGCTGGCACA
ACAATCCTCTGCAGATACTCAGCAGCATCTTTCGCCGCTGTTTCATCAGCCTCGAGCTGCTCCGCATTCGTTGAAGCCGCATAATCCATGAAGACGTTCG
GGTTCAAGAGCACCGGAGGAACCGCAGCCGTCTCCTCTTCCTCATCGGCCTCCTCAGTCTCCTTCTTCTCGGACGTAGCATCTTCCTTCTTCTCAGTGTC
AGCCTCAGCACCATTCTCCTTATTCTCATTTGCTTCCTCCGCCTTCTTCGCTTCCTTTGCTGCAATGCGAGCCTCACGGTTGACACGGCGGGCTTGGTTC
TGTTTCCAAAGCGAGTACAACTGGACCAGTTCCGGGCGCAGCAGAGCCGCGTAGCCTTCGTCATTGCGAGTGAAGCACAATCCATCTTCTTCGGACGGAA
TAGACTTCTCCTCCTGTTTCTTTAGTGCAGTGTCGCGGCTCTTATAAAATGTCCAATCCTTCGGCGTGATGCGGACCAGATCCAGGACATACAGACGGCC
ATCAGAGCCCTGGATACCCTTGGCCTCCACAGCACCACAGATGGTTGCCACATCGGTGCTTGCCTCACCACCGCTACCAGGTGCAACACCAAGAGCCTCC
TGTTCCTTCTCAACGGCCAGGTCTTCTTCGGTCTTACCAAGAGGCTTAATGCTACGCTCTGCAATGTGCAGCTTCTCGCCCGCCTCGAGCATGAGCTTGT
GCATCTTGTTGTTGGCAGCAATGGTCTTTCCGTGGTCCACAGAGCCGTACACCAGCTTAGAAGCTGCATCTCCCATCAGGATGCCCGGGATAATACTCTG
GGCAATAACACGGACACCAAGGTAGTCCACAACCGTCGTGGCCAGGGTGTGGAGACCACGGACATCCGCCTCGTTGAACGCCTTCACACCTTGCAGGTCT
CGGTTGGCAGCCGAGTAGGCGTTCTCCTCTCCTCCAGCGGCATCTTTGGTGGAGTTGCCGTCGATCGACATCGAGAAGAAAATGTTGTTGAAAACGTATA
CGTGCGCACTCTTGTCGTCCATGGGGTTGATAGGAGGAATGTGTCCCTCAACGATAGCAACCGAGCCCTGGGTTGCTGCTTCCACGAACTCCGTCACAAT
CTTGTACATGACACGAGCGCGCACAATTTCGTCCTTCAGCGAGTCGGTCGGCAGCTCACGGCAGCATTGATACTCCTCGTTCCAGTCACGCAGCACGCCA
CGCTCATCCATGCCGAAGGACGCGCAAAGTTCGTCTTCAGCGCGATTGAGGTCGTACGTGTGCTCCTCAGTCGCCGTGGCAGCAGGGGTGTTCCACGGCA
GCTTGCCACCCAAGCTTGATCCAGCCGCCACCATCCACTCGATAGAAGAAGGCCCCTCCTTCGCCAGAGAAGCAGCCTTAGCAAGGAGAGCAGCGTACGA
CTCCCTGAACTTCGGCGATACGGAGCTCAACACATCCACCAGCAGATGCGCGTGGGCCGCAGCGGTCTTGTGCGGACGCGGGTCGAACTTGGTGGCCGTC
GAGCGGTTCACAAAGAACCCATTGACGTGCGCCGTGATGTGGTAGCGCGTGTTATCGCCAGCAACCACCACCTCCAGGTAGAGCAAGTCACCCGCGAGTT
TGCGGGGTCCTGGCGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGACACAGGTAGGGAGTTTGGCATCCTGCTGCTTCTGCTCCGGCTCCTTGTGTTG
GTTGGCCTCGTTCTGCTTCTGCTTCAGCTGGTTCTTCTTCCCTTTCTTCGCCTTCTTCTGGTCCTTGGCCGGCGTTGGCTCCGCGTCCTCCTGCGCGACG
GGGGTTGGGAAGGCGTAGAACTCGGCGAGCTCGGGTTTCACTGGGACTTCGACCCCCTCGAGCTTGTGGTGGATCTCGCGCAGACGCTTGAGCTGCTTTT
CGGACATCTCCTTCAGCGCCTTGTCGTCCGGCTCCTCATTACTGGTATCGGTCACACCTTCCGGCTGAGCCTCGGGCTCCGTGGCTACCTGGGGGATGGG
CGGATTGTTTAGCACGTCCCGGAAGCGACGCACATGGCCGCGCACCTTGCGGGCGTCGAACTTGTCCAGTGCCATGCGCAGCGTCACGCCGTCCGCCACA
CTCTCGTACTCGCCCAGCTCCACAAAGTCATTGAGCGGCTGCCAGGAGCCGTCCGCCGAGCTCTTGGCCTCCAGGTGGTAGCTCGTGTAGCATGCGAGCG
CTGGGAACTCGGCGATGAGCTGGCGCAGAGACACGACCGTGTCCGAGGCCCCCACGCTTTCGAGCCGCACGCACTGGCCGCTCTTGGCGGCGGGAGGCGC
CACCAGCACACTGAAGGTTTGCTCTTCCAGGGCCAGGAGCTCTGCCGGCTGCTGCTCTGCCGGCTGCTCGACGGTGTCGCTGCTGCCCATGATGCGTGGA
ATCTGCTTGCTTTACGGGGCTGTCGTTGCGATCTGAGCAATTGTGTGGTGCGTGGGCAAGACCGAAAAGGCTGATGGACCATTGCAAAGGGGCAATGGCA
AGACAGTCATTTACCGAATTTGTTCAAGAATAAGTAGTGCCTCGTGCTGGTCCGATAGCAAAAGTCAGTCAAACGGGTTTGACGGGTATGCTATATCAGA
GGCTTGAAGTTGTCTTTCATCTTCAGATTGTGGCAAATCACTTGGTGTTTGTAAGAGATCAGGCGAAGTACGTCATGTATCTGGCAGACGCACCGGAAAA
GCCCACCGAGAATGGAGAGCATCTTGGCACTGGAGCTGTAACGAGCACCACGTCAAGCCACATCTGGGCACTGGAGCTGCAACGAGCACCCCGTCAAGCC
CGCATGCCTCCGTTCACCCAACATGAACAGACTTTGCATCAACCACCAGCACCAGCGCTTTTGTACCAGTTTTGATGGATACGTTGGTGTGTGCCACACA
CAGACATGCTCATCCGAGCCCTTCGCCGCAGCTTCCTGGCGTCCGGACCTACCTCGTTGTCGCGTCGCTCACTTGCGCCCTTCACCTGCCGCACCATGAG
TTCCGATGAGCGCGCCCAGGCCGACGCTGCGGCCGCCTCGGGTGCTGCCTCCGCCGTGGGCGAGACCATCTTCGACAAGATCATCAACGGGCAGATCCCG
GCCAAGATCGCGTACGAAGACGCGCAGTGTCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCGTGCACATCCTGCTCATCCCCAAGAAGCGCGACGGCC
TCACGCAGCTCGCGCACGCCGAGGAGCGCCACGAAGCCGTGCTAGGCCACCTGCTGTACACTGCCAAGCTGGTCGCCAAGCAGCAGAACCTGGACAAGGG
CTTCCGCATCGTCATCAACGATGGAGAGGACGGCTGCCAATCGGTCTTCCACCTGCACCTGCACCTTCTTGGGGACGCAAGCTGGGCTGGCCTCCTGGAT
AAACGAGGACATCGGCCGCCGCCCTGTGTCAATGAGGGCCCATGGACCTCTGCGAATTATTCAGGTACAGGCGTGTATGTTTGAGGTAACCAATGCTACG
ATGCTGGCCTACTACGCGTAGTTACTTGGTCAACGTTATGGCGGTCTTTGAGGGCGCCACTTGGTTGTCTGGGCGGTCTATCCTCGGCCGCTGATCTCTT
TGAGGAATTGATCCAGGAACGTCTCCATGAACGCGTGGCGCTCTTCTGCCAAGCGCTTGCCGGCGTTGGTCTTCATCATGCCGCGGAGCTTCAGCAGTTT
CTGCAATGACAACAAAGTTCCCAGACGTTAGACAAGAGCACCACCGGAATTAGACAGCGACGTACCTCGTAAAAGTGGTTGATCGTGGTGTTGGGGCGGT
TCGGGTCCATGTACTGCTCCTTGGTCATGTCGTCAATTGGAGGCACATCCGGGTCGTACAGCGGCCGCAGCTTGTGCCCTCCGAACGTGAAGCACCGTGC
GATTCCAATGGCTCCAATCGCATCCTGCACGTCAGAAGCGGAAACGTTGTCAATCAGCACAAATGTCCGTTGCTGTTAGTGGACAGATAACCTACCAGTC
GGTCGGCATCCTGGACGCAGCCATATTCGATCGAGTACGATCGCTGGCAACACCAAGCAACGAACAGCATTAGCCACATGACTCCCATCCAACCAAACCA
TCGCCACTCAAAAGGTAGCATACCGAGCCGCTGCCAGCCAGCTCCTCCTTGAACCCCATGCTGTCAATGATAGTCATCACGCGCTCAATCTTGTCGCGGG
GCACGCTCTCCGACTGCAAGAAAGCCACCGCGCGCTTCGTGGGCTTGTCCTTGTCGCTCTGGTATTTCCAGTCGTCGATATCGTGCAGCAGCGCCGCCAA
GTCCACGATCTCCAGACTCTCCGCTGGCACTCGCTGTGTGGCACACGATGCACCCGTCAGCAACAGTCACGCGCTCCCAATCCTCCGCTGCAGCAAACCT
CCTCCCTGGCCAGCGTCCTCGCCACCGTCCACACGCGCTCGATGTGGCGCCAGTCGTGGGACGCGTCGTTGCTCTTGAGCTGCTGCTCCACGAACGCCGC
TGTGCGCTGCACCAATCGAGAGGTAGCCATCCTGGTCCGAGGCAAATTGCGCAATGAACAAGACAAAGCACAACCATCAGCTGTCGTACAGCGCCGCCAC
TTGGGGTTCGAGTTGCTGCTGCTTGGCGCGAACATTACTCGTCTCTGATTGGCTAACTCGCACACCTTCAACATTGAAACTCCCCGCAGTTCCCCAAGAG
GCAGCACCATGAGCAGCTCCCGTAGCCGGGGCCCGACCCATGCGGCGGTGACCGCCAAGAGCGAGCGGCCCCGCAAGATCACGGCCAAGGCGGACGAGCT
GGACGCTTACATGGAGAAGCTCTACGACGACGACGTCGAGTCTAAGCTGGACGGGGCCAAGATGATTCTGCAGCTGGCCGAGTTCGCCGGCAACATCGAG
GCACTCGTGCAGAACGAGTCGCTCATGGTGCGTTCGGGTGGTAATAGCGTACTAGTTGCGCTGCTGATTGCTGTGTTGTTGCTTAGAGCCTGCTGTCGCG
CGTTCTGAACGACGACTACAAGAAGAGCTATGACTTTTCGCTTACCATGATGCGCATCTTCTGGTGCTTCTCCAACTTCTTGCAGCTGCATCCAGTGCTG
GGCAACTACCGCATCGGAGCCATCACACTCAAGATCGTCGAATTCGAGCTCAAGCGCCACCAGCTCCGGCAAGAAGAGGAGAAACTTCTCGAGAGTGCAG
TCAACGGAGCCCCAACAAAGGGAGAATCAACTGACGGCATCCTAGCGAAACTAGACCGCGAGAAGAAACGCAACAAGAAGCGTATGAAGAAACAGGACCA
ACTACTGTGAGAATCCTTCGATGGCAGCGGGATATTTGTGACTGACTCGAAAATTCGTTCTTGTAGCAATGTTTGCTTCAGCGTGTTGCTCAACTTGGCC
GAGGACATTCACACGGAGCGCAAAATGGTCAAGCGCAAGATTGTGTTTTTCCTGACCAAGGTTCGTGTCTGTATTTAAGCTGCTGGCCGGCTTGGATGTC
AAACGTTTGTAACTTACATGGTTTATTTGCTGCGTAGCTGCTGGATCGCGTGGCTCCTGACTTGGTTATCCTTACGATCACTTTCCTCAAGAAGCTGAGC
ATTTTTGAGGAGAACAAGGACGCAATGGTGGAGCTTACCGTCGTGGAGAAACTCGTTCGCTATCTCAACTGCAACCACGACAAAACAATCCAGACGGCAC
TCAAGCTGCTGTTTAACCTTTCTTTCGATCCAGCTATCCGTGAAGTGCTGGTGCGGAATAGCCTTATTCCAAAACTTGTGGAGCTACTCAAGAAACCTCC
CTTTCGTGCATTGTCACTGCGGATTCTCTATCACCTAAGTATCGATGATCGATGCAAGTCCATGTTCACGTACACGGAGGCTATCCCGATTGTCATGCAA
CTCGTGATAAATTTTCCGCAGAACATCGTGGCAAAAGAGCTGGCTGCTCTGGCGGTGAACCTCAGCCACAATGCGCGCAACGCCGAGCTCATGTGCCAGA
ACCGCGGTCTAGAAGCACTTGCAACACGCGTGTTCCGCACGCGTGACCCGCTCCTGATGAAGGTGATCCGAAACATTTCACTTTGGTCATATACGCTACA
AGAAGACTTGGTCAGCGATAAGGCGTATAAGTACCGTGGTATGTGGGCTCCATTCGTGGTTCCGTTAATCGAGCTGTGTATCAACACCGACAACCACGAC
TTTTCGATCGAAGTTCTGGCAACGCTAGCCAACATGACACCTAGTGATTTGCCTCCAAAGACATCATGGACAAATTGGTGACGGATCAATCGTTAATCCC
TTTCCTCAACAAAATGCTGGTGCCAGGCTTTTCGCAAGACGATATGATTCTTGAAGTCGTGCTTTTCGTTAGTGCACTCGCGCTGGAACCGAAGTGTGCT
CCTCTCTTATCGTCATCTCGGCTGGTGCGCACGTTCCACTCGCTGTTCCAAGAGAAGCAACACGATAACGAGCTCACATTGCAGTTGCTTTACGCGTTCT
ACCGCATGCTTCGCCACCCCGAAACCTTTGAGGAAATTCTCTTTGGAGTAGGGTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCATCAAGCATTGAAGT
CCGCCGGATGTGCGACGTGCTCATGGACTTGATTCTCGACCACGATCTCAATGACGGTGCCATCGGCGACTTTGGACACCTCATTCGGCAACGCAGGTTT
GAAATCCACAACGCTGAGTATCTCGAAATGATCCATGCAGAAGCACAAAATGCAAACTACCGCAAGCACCACGGAATGGATGACAATGGTGGCAAGGAGG
ACGACGATGATAACTAAGCGGCCAGAGTATCATCATCCGGAACCAGTCAAACTCATTAAAAGACCGCGTATACTTCTGTAGCCAGACTTAAACCTTTAAT
CCTTGCGGTAAACTGTTCCACGCAGTATTCTTGCCTGCAACGATCCTACTTCACAAACTCAACTAATCCTTTTCCTCGTCAGGAACCCAACCACGCTCTT
CCGGTCAATGCCAAAGCGAGGCAGTGCCTTTTCCGGCCAATACGTATTGTCCTCGCTGTTAATGGACGCCCCCGGTGGAATCACGTACATGCTGTACGGA
CAATTTGGTGATATGGTCATTGCAAGCGCGCGAGAGTTGTGTTTCCTTTTGTCCGAGTAGCGAACGAGTTGCCGCACGAATTTCCAATGGTCATACGCCG
ACTCTAGACAAAAAAATGTCATAGCCGATTCATGGAGATTACGCACTTCTGTCTCCAGTCTTTCCATCCCGACAGTTCCTCGCTGCGTCACCACTATACT
TGGGCTCTCGGGAAATTCTTCAGGGATCATTCCGTCTCGCGTACGGCACCAGAAGGCATCCACGCGAAACTCATGGTAAGTGTTGGTATCGGATGCGTCC
TGAATCTGGATACAGCATGACCAAGCGACGGAGTTCCGGATCATTGGATTGTCGATCTCCATCTTTTGATCTTCTCCCTCGGGAAGCTTTGAATCAAGGC
CACAATCAATCAAATCAATGAAAAACTGTGCTGCTCTCCACTCAGCCAAGCGACGGGCCTCCGCTTCTGTTTTCCATGTAGCTCTACAGAGAGCATGGCC
ATCGACTCGAACGACACAGTGCACACCAGGGGGTGAGCGAGAATCTCTGCCAAACGAAGCACGAGGAGGATCTTCCACAGCAGTTGTTATCTGTTGCGAA
GCACACTTACGGTTAGTTCGAACGAGTAGCATTCATAGCGAAGAAATACACGTACACTGGCGATGCCTGACAGCTTTAGAGCTCGAAAGGAATCCTCAGA
TGAAACATAGGCCAGAGATTTCACGTCCAGAAAATGAAGAAGTTGAGCCCAGATCGAGCGGATCCTGTTTAGCCTGTCCAACATGCCATCGACAGCAGCA
TTACAAGCTTCAGGCTTCGCCATTTTCGATGCTTTGAAGCGGATGACGTCGTTGACATCAACAAGAACTTCAAATACGCCTTCTCGCAGGCGTTCCATGC
TGATATTTGCCGTGACATTGGGGACAATTCTTCTGTGTTCAGCCCCCCGGTACTTCAGCGATGCTCGAAGTCTGTTAATACCAGCGCATAATTCATCTGT
TGGTGTAAACAGACTTCGAATTGCGGCGCGAAATTTGCCATCGTCGGTGTTCTCGCTCTCAGACACCTCATTATAGTTTTTTTTCATTTCATTCTCAAAG
GCTGCCTCATCTGCTGCAGCGCTGACATCTTGTGAGGCTTTGACTGCGGACGGATCCCAGTCATCATCAAACCCACCGTCTGAATAGTTATCGTAGTCGT
CGTCGTCCATCTCATCGTCGCTGCACAATACGAGATTAGACTTCTTCACTTGAGTTGTTGTCGGGGGGCGAGATTGGTTCGTTCCTGTGGATGTCGATGC
TGGTGCTGCATTTGTTGTGTTGTTGCTTCCATTTGAGGAGCACGACGGGGTAGATACGGATATCATCTTGTTCAATGATTGCAGGATGTCGCGCCATTTT
TCATTTGCAGACCGTTTGGCATCTTTCGCGTTCAGGCATGCTGTCGAAATGGCCAGTGTGTTGCGCACTCGAATGAAATACATGTACAAGGGCGGAACGA
GCTTTTCCGACGCCGAAACCTGAAAGGACCTTGTGTTAGTCTCCCTTAGGGCCAACAATGCAGTACTTCGAAGTAGTTAGCCAGCCGTACCTTGTCATGA
TTCTTTGCTTGCGTTTCGTTGCCTGCCATCAAAGTTGTGGGCGTTTCAATTAGTCGTTCGTTGTACGTGACGAGCAACGCTTTCCACGTTTCAATCATCC
CATCCAGTGTGTTTATCAAAACAGAAATTGCCTTGTCCTTCGCGATTTCAATCGACGACCCTTCTCCTTTTGCTTCGACCACGCCTTCGGATGCAGAAAG
CACACAGCTAACAAGACCACTGTTTTCCTTCGTAGCAATCCGGCGGATCTGGAATGCAATGTAGACATCACACTAAGTAAAACGTACTAAACTATACGAA
GCAGGAAAAATACCTTCCGATACATACCGATAGATTGGACGAAAGCTGAATAGTTTCGGACTGCACACGCAAATTCCACACGATCGATCTTACAGTTTGC
TCGGTCCTCTCCCGATCTCGAAATAGGAACATCAGAAGTTCCTGGTAAGCGTCAGATTTTGCTTTTGAGGCTTCATCTTCGGAACGAGGGGGTCCATCAC
TATTGGCCTGCGAGCCGCTTCGATCTTCAATGAAGATGTTTGCTTCTGCTTCGGCACCAGAGATTCTCTCAGCTCTGTTTTCGGAATATTTCCTTTCAGG
AAGTGGTGGTATTTCGGATTCTGGGGCTGAGTACTCCAGTCGGGGACGAGGAGCACCACGCTCGTCCTCGTAAGTGTCATTTGCATTTGGTGCGTAGTGT
CGCTTTCGTAAAATGCCCATAGACCTTAGCTCAGCATCTCTCGAGCCGACATTTTCGCTGCTCACGCTGTTTTCGCGCATGGAATCCACCTCGCTGTGGT
TATAATATGGCTGGGCATCTTCAGTCGCGCTTGGCTCATAACTGCTGGTCCACGCATCTCCATGGTGGGGTTGAACACTTTCTATCTTGGTCGGTTCAAA
GTCGTTCGCATGGTGCTCTGCGCGGTCGAGCATCAGACTCTCCTCGTGCTGATCAATTAATTCCATCAGGAACAGCATCAGTGCGTCAACTGTCTCACTT
TTAACGCTGGGTAAAGATGAACCACGCCTCCAAACGAGTGGGAGCTCTTGGATTAGAGCAACTACGTCATAGTTAGTATCGTTATCAGTGGGCTCTGCAG
TGGGTTTCTCGTACAGCTGCACAATCCAATAACTTATCAGTCTAATATCAACATGCCAGCCAAGCAAATGTGCGTACCCGAACAATTTTCTTCGAGATCA
GATAGTTGAAAGATGCATCTTTCACCCTTCTGGTATCATTCGCGATACAGAGGCCGAATTGAGACTTCAGATGCAGCAGCATGTCGCCATACAGTCTTCG
ATGTTCAACTACAGCCCTTGTAAGCTGCGACAAAGCTCGGATAGTTGCATCACGATCGACAGATGCAGTGCACTCAAATGACAAATTTCCTAGTCGAACC
CGAGCAATGTACTGGGCCGAATCAACCATCCGCAACTCTCGCCGAAGCTGCGCGGAAACAACCGTCAACCAAAGTATTCAGGGAATGAGGAAAACAGAGA
GCTTACCTTGAGTCCCGCAGCCAAGATAAACTCTTTACTCATTGCTGACAGCGACACAGTTTGGACAGCTTTTCCTAGTCCTTGAAGCGATGACACGAGG
TCGATATTAGGGCCAACCAAAGCAAGGAGGTACGATCGGCCCTCCTCAACACCGAAAGTTCTCTGCTTGGCGGGGATACTTTTGTCACTCTGTTGGCCCT
GCTGAGTGGGTGGAGGAGGTAGAGGTGCTGGAGTCGGTGTCGGAGCTGAAGCTCTAGCGGCCTCAGAGACTGGCTCAGTCACGCTTACATGGATCGGCGC
GGCATCTATAGCAAAAGTCACCCGTTTCTTCGGCGCAGTCCGTGCGGCAAATTGAGAACCTTTGTGGCGCAGTATCGACGTAGTGCTCGGTGCACCGGCA
GGGTTGCTGTCATAGCTCTCGTCGATCGTATCGACTGCCATGTCCACAGGTTCCTCAGCCATGTCCACGTCCTTGTCTTGTCCTTGTTTGCTCCGTTGCC
CACCCCCTGCTCACGCATCAATTCCGCATACCACTTCCGGAATTTGTCGGCGAATTGGAACTTCCTGTCCTCCATCAACGTGTTCCTCATGTCTCCCGTC
ATGATCTTCACGTACATCAGCAGCTTCTTGGCCGAGTGTAAGCGCTGCACTGCCACTCGGTCCTGTCTGATCAGCCCCTCGTAGCGTTCAGCCAACTGCT
GGTGGTGCGTGTCCATCTCGTCCAGGAGGCGGAGAACGCGACCAGGCGTGCGTCCCTGTCTCGGATCGTCCCGAGCCGCCGCCCCCATGCGTACGAAGCG
CAGCACAACCGTCCTCCTCGTCGCCTTGTCCTGCTCCTGCTTAATGTGAACTTGTGCCCCAATAGCAGCCACGTCCTTATGCAGCTGCTTGAGTTTCCTG
GGGCACAAGAGGAAGTCCTCGATGCCCATTCCCACGAAATAGTCGTCCGGTTCCACGGTGCAGATGGGCTCCAGGGCAGCGCATTTGCCCGCCACTTTGT
CCTCGAACGCCATGGGAAACTGCGGCGGCGCTGTCTTCTGCACTTGGAACAGGTGCGAGCTCATGATGGCGGTCACTGACACGCCCATGCTCGCGAGCTG
CAGGTCACCAACGGGCCCACGGGGAAGCGAGTAGTGCACCTCGAAGGCGCGGCCTAGTGACAGCAGCTTGCGAGCAGCGAGCGTCGTCTCCACGCGCCAC
AGACGCACGCTCATGTCGAACGCCAGGTCTTGGTTGAGCTCGGGAAGCGGCTCCATGCTGTCCGCCCAGGGCGCCATGTTCCAGGCTCTGCCGACAACTG
GATGTCACTGTGTGTGGCACTACGGAATGACTGGATTTCACTATACCAGTTGGTGCCAAGAGGGACAATGCTCGCGGCTTGTGTGTGTATTACTTATGTT
AATACTGTCTACTCCATGAGGAAGATGCGGCTGGCAACGTCGCCGACGAGCCAGTCGATGCCGTCCACGAGGCCGTCGCCAGTGACGGCGCTGCACGAGA
CGATACTCCAGTGGCGGGTGGAAAACTGAGCCGACCGCAGCCCCAAAGCGTCTGCGATCTCCGCGGAGGAGAGAGCGCCAGGCAGGTCCTGCTTGTTGGC
AAAGATGAGCAGCGTAGCGCCTGCTAGTTTCTGCAAATACGGTAGCAGCCAGCAGTCAGAGAAGCAGCAACTTCAGGAGGATCTTATGAACGCACCTCTT
GCGTCAGCAGACTCGAGAGCTCGCGCTTGCAGTCTTCGAGTCGCCGTCGATCGGCGCTGTCCACGACCCACACGAGGCCATCCGTCTGTCGAAGCACACA
TCCACTGTAAGCTTCCTTTATACTTCAGTGTATACAGCCTGCCGCTTCCAGACCTGCTCGAAGTAGTTTCTCCAGTACGAGCGAATCGTTTGCTGTCCGC
CGACGTCCCAGACATTCAACTTGAAGCTGGCAGTGACAGCAACACAGCGACCATGAACCTCGCACTTGCACAGAACCCACCGCGCACACTCACTCTTTGT
ACTCAAGTGTCTGGATGTCGAACCCCAGCGTTGGAGAGATCTCGGTGATGTCCTGGCCCATGAACTTCTTCAGGATTGTCGTCTTGCCGGCGTTGTCCAA
GCCACTACAGCAACAGCAAGCGCGTCAGCCCCAGTAAACGACCTCTAGCACTAAGAGTGAAGATAGCAACGCACAGCATAAGGACTCGGATCTCCTTCTC
CTTCTCCTTGACCTTCTTGAGGATACTCAGCAGCCCCATGATGCGATTCGCCTTGGTGATCTAAAGTAAATTGCCGAACGGGAAGTAATTTATTTGTAAA
CTACCGTCACGAAAGGGCATGAAACGACGCTTACGTTAGGTAGTTCAAGCGCAGCGCAATTGCAGTTAGTACTACGTAGTCGATACGCCATGACCAAAGC
CGCCCCACCTAGACGCTTACTGCTGAAGAAGTGCGATGGGAACCAGGAGGACGTAAACGCTTTCGATCCGAGCAGTCGGTCGACCAAGGCGCATTTCCCC
CTGCAACAGGAGCAGTCTTCAAAAGAAGATGCAGATCCGTTCGAGAGCAGAAGAGCTTGCAGACACACGTCATTGGAAGAGCTACTAGATCTGGAACTGG
ATTTGATCCTGCCTGTCACTGCAATTCCAGCTCCGACGAGCAACCAGTTGCCTGTTTGTGCTGCAAACGAGGAGCTGGAGGCCGACGTCGACTCCGTCTC
ACTGGAGCTGCTGGTACGAACGAGCGAGCAACCATAGTCGTAAATGACAACTCACATGACTCGTATGTGTTGATGATGCAGGCGATGCAGAGCCCACACG
GCGAGAATCAGCAATGGCTAAGCGAAGAAGACGAGCAAGACGCGAATTCCGTGCCAAGCGCGATCACCGTTCGACCAGAGGAACAGTCTCCACGGCCTAC
TGTGAAAGGAGCGTCGGCTTCTAGAAAACCGATGGCGCTTCATCTCGTGTCGCCGACAGCGTTTGTACCATCGTTCCCTCCATCACCGAGCCAGTCGTCG
ACAGACGAGGACTATGGTTTAGCATCGCCGATGGCGCTGCCAGACACACCTTCACAGTCTCAATCAGGGATCACTTTAACCTGGGACCTTGCACCAACCT
CTCCTACCTACGAAGATACTTATACAAGAGCAGGAACTTCTCGTGGATTCGCACAGTCCAAGAGCGTCCAAAGACCAGAGCGTCGAACCCCTCGATTTTC
AGCTGCAGCTAGAGCTGCAACACCAAACCCACGAAACCACGGAAGCTATGCACCGGACCGAGCTACGGCACGGATAACACGGTCTGCACTTCCAACGCTA
CCGGAAGGCCGAGGCAAGGCTAGGCATGGCGGAATCTACTCATTGTTACTCAAGAATAAATCTGGGAAACAGGAGCCGATGCTCGTTGAGGACGCACACA
ATTCCGACGGTACGCTGCTGTGGTTTGATGGTACAGAGGAAATTTTTGGTACTGATTTCTATCCCTCAGGTATGACTCAGGCGCCTTCCGTTTCTAAGGC
GAGTGCGTGCAAGCAAAAACACGGAGGTATCTACAAAATGCTGAGAAATTATAAATAATTTCTCATGTTATACACGGTTCTCTCCGTTTCTCTCTCATAA
CGCTATCCATAGCTCGAGTTTCATTTCGTGCCGACCATCCTGGATTTTGTGGATACACATGTTACCCGGTAATTTACCCTGTAATCTATTCTTTTTTTGC
TTATTGCATCATCAAGAGAAGAGCGCACCGAGATGAACCGCATTTTCGGCAAGAAGAAGGCCGAGGCACCCTCCGTCAACGTCTCCGATGTAGGGGGAAA
GGTGGACGCGCGGATCACCGACCTCGACATGAAGGTAAGTGGCTGGGACTTGCGCTGCGGCTAATGAGCGCCGCTGACCGAGTAAACCCCAGATAGAGAA
ACTGGATCAGGAGCTCCGGAAGCACCGGGAGCAGATGAAAAAGACGCGGGGCCCAGCGCTCAATACTGTGAAACAGCGAGCCATGCAGACACTCAAGCGG
AAGAAGATGTTCGAGGCGCAACGGGACAAACTGACAGCCCAGTCCTTCAATATTGAGCAGGTGCCTTGGACAGATTGACGGGCGTTGATGGGCGTCCGAG
GCTGGTACCGAACGCTGATCCTGTGCGTGTATGCTCCGCTATCGAACTCTCTGGATTGCAGGCCTCGTTTGCCATTGACACATCAAGGGACACAATCTCA
ACTGTGGCTGCCATGAAGAGCGCAGCGGTGCAACTGAAGGCAGAGACACAGAAAATCGACATTTCCGAGCTGGAGGTGAGACTGGCCACATTAACTATGT
TGCGTATAGCGAGCTATTTGCTGATGCGCCCTGTGCGATTATGCGTGGAGCAGGACGTGCAAGACGACATGGCGGATTTGATGGAGGATATGAACGAGAT
CCAAGAGATCATGGGGCGCTCGTACGGGTACGTACTTGCAGCACCTTATCACTGCTTGCCTGAAGTCACAATGCGAGCATATCTGACCGTGTGATGTTCG
GGCATTTTTGCCTATCTGCAGCATCGGCGACGAAATCGACGAAGACGAGTTGGAAGCGGAGCTGGAGGGGCTGGAGGAAGAGTGGGCTGAGGAAGAGGCG
CTTGGAGAGGAAGCAGAGTCGGCGCCGTCGTACCTTGCACCAGCCCAGCACCACGAGCTGCCTGCCGCCCCCTCGGGCATCTTAGACTCGGGTACCACAG
CTCGCGCTACCGACGAGTTCGGGCTTCCTGTAGCGTCCTACTCTACGTAGCGCTGCAAGCTGCACACCCAGCAAAACACAAGACCTTACCAATACATTTG
CAGCACATTCGCAATACAGCCATGTGTCATTGCGCAGTTCGTGTCGCTGTCAGCCAAGCGTTGGATCGTGGCCACGCACTTGTCAAACATGGACCGGGAG
AGATGGCTACATTATACCACGTCAGCGGAGCTACGCTATTGGCCGAGCTTAGACAGCCAATCATTTTTCGGAATCACGTTTGACAGGGTAAAAAATGAAT
ATTACAGGATATGTATTATCACAAGGTGGTTATTGATGTATTTGTAAAGCAAGTGTATCTTTCCCTCGCACGAATTCGTTTATATCATTCGCGAGGTTTT
TTATCCCCGAGGTTTTATCATTCCAAGCAAAATTTGGTTGCGCTCACTTTGGTATTGGTGGTTTTGGCAGCGCTTCGTCCAGATTCCAAGCAGCAGTCTC
GCAGGTATGGCCCGCGAAAGCAAAGGAGCCGCGCGTGAAGCGCGAACGCAAGGGAAAGAAGGAGTCGCGCAAGAAAGCGGCCGAGGAGAAGAAGGCTGCC
GAGAAGGCCGAGGCGCTCGAGAACATGTCGCACGCCGACCGCTTGGCCGAGGAAGGCATCATCGCCACGTGCTCGCACAACGTGCGCTCGGTTCACAAGA
ACTTCAAGGACATCAATGTGCTCAACTTCAGTATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTTCGGCCGGCGCTACGG
CCTCATCGGTCGCAACGGTTCGGGTAAGTCCACCTTCATGAACGTGCTAGGCGCGCGCGGTATCCCCATTCCGGAGAGCATCGACATCTACCACCTTAAG
CACGAAATCGAGGCCAGTGACATGACGGCGCTCGAGGCCGTGCTCTCCGTGGACGAGGAGCGCAACAAGCTCCAGGCCGAAGCTGACGCTCTCTCGGAGA
AGATGACCGACGATTCCATCAGCGAGGAAGACAGCGAGGCCATCTCTGACCGTCTGACGGACCTGTACGAGCGTCTCGATGACATGGACGCCGCTACGGC
CGAGGTCCGCGCTCGTCAGATTCTGTCGGGTTTGACGTTCTCGGACGCCATGATGGAGAAGAAGACTAAGGAGTTTTCCGGTGGGTGGCGTATGCGTATC
GCGCTCGCCCGTGCTCTGTTCATTCAGCCGACCCTGCTGCTGCTCGATGAGCCTACCAACCACTTGGATATGGAGGCTGTCGTCTGGCTGGAGGACTACC
TGTCCAAGTGGAAGAAGATCCTGCTCATGATTTCGCACTCACAGGAGTTTATGAACGAAGTCTGCACGAACATTATCGATCTCACCAACAAGAAGCTCGA
GTACTACAATGGTAACTACGACACGTACGTGCGCACCAAGGCTGAAAAGGAGGAGAACCAGATGAAGCGTTACAACTGGGAGCAGGAACAGATCAAGCAC
ATGAAGGAGTACATTGCCAAGTTCGGTCACGGTTCCGCTAAGCTTGCCCGTCAGGCTCAGAGTAAGGAAAAGACGCTGGCCAAGATGGTGCGTGACGGTC
TCACGGAGAAGGTCGAGCAAGAAATGATCGGTGACTTCAAGTTCCCCAACCCGGAACCGCTCCCTCCTCCGGTTCTCATGTTCCAGAATGTGGCTTTCGG
TTACCCGGATTGCCCCCTGCTATACTCCGGCGTTGAGATGGGACTTGACCTGGATTCCCGTGTGGCTCTAGTCGGTGCCAATGGTACTGGTAAGACAACC
CTGCTCAAGCTTATCACAGGAGATCTGGTGGCGCGAGAGGGTAACGTCCGACCACACAGCAAACTTCGCATTGCGCGATTCAGCCAGCACTTTGTGGATG
TGCTGGACCTGACGAAGACCCCGCTTGAATACTTCCGCTCGCTCTTCCAGACGAAGTCTGTTGAGGATGTCCGTAGCTACCTCGGCCGCTACGGCATCAC
CGGTGAGGTGCAAACACAGATCATGGGTCAGCTTTCTGACGGACAGAAGAGTCGTGTGGTGTTTGCGTACATGGCGCAGCAGAATGCACACATGCTGCTG
CTGGATGAGCCCACGAATCACTTGGATATGGAGTCTATTGATGCACTGGCTCGCGCTATTAACAACTTCGAGGGTGGCATGTTGCTGGTGAGTCACGACA
TGCGATTGATTTCGCAGGTCGCCAAGGAGATTTGGCTTGTAGAGAACCAGTCTATCAAGGTCTACCAGGGTGAGATTTCCGACTTCAAGATGCGCGTGCG
TAAGCAGCTCAAATTGGCGGACAAGGAACCTGCCAAGGGTGCCGAGTAAATGCTCATGATAGCTTTCTTCTCATTAGATCACCTCTACATGTAGAGCTGT
TGAGGCAACCGCTGAAGCATTTTCTTAGCACGCTGTTCTGTTCATATTTGATTCCCTTGCCGACAGATAACATAGATTGAAAAATCACACGTTGGTAGTT
GATGAAGTT