Description :
From Genome Similarity Track
Location :
Scaffold_1479:1989- 8474
Transcript NameFunction/comments
Phypl_g13517reverse transcriptase

Sequence
6485 bases(100 bases per row)
GTACCTCGCCCAGATTGGATCCCTGGCTACCGGCATAGGCTCGAGTTCCCGCAAGCCGCCATAACTCCATGGCGTCCCCGTCGAATTCGCAAGGTCTCCG
TATTGGAGATGAAAATCTCCGTTTTGTTCCATCACTTTGCCCAGCCCAAGAACTGGCTCTTTCCTCTGAAGGAGTCAGGtgcttcgccttctccgtcgct
cTGGTCCCCCCATTCGCTCACCGAGACCAACATCAGGGCACTATATGCAACCAGCCCGTGGATCGTGCTTTGTACGGTGGTGACGCCGATCTCGTTTCCC
ATGAGTGGTTGGTTCGAGGCCTTGGTGCGACGATATATCCGGCTTGAAGACGAGCACCGGCAGGCGTTATGGGAAGCTGCTCACGGACTCCCGATCAGCT
CCGCTCTACGCAAAAATACCCATTCCTGAAAACGTTCTGTGCGGAACGCAAGCAACGGCGATGTCGCTTGGGGGCACGTTGGAAGACGTTTCTCAAGGCG
GTCCTGAAAGGAATGATCTTAGGCCACTGCGATCTGGACATACTCCTCGATCCGTTCTTCCGGCAGTACCCCCGGCACAACGAGAAGCGTTTGTGGTATC
CGGGTCTTGGACGCCATCCCCAACCTGTCAACCTAGTGGAGGCTCTCCACGCTGTCGACTTGGCGGAGTCGTGGCGCAACCAGTATCGCGCCAACATTCA
AGATCACCCCGGCTCCCAGATCGCTCGTTTGGTCGACAAATTCACTTCCGTCGACGCCAATAGTGACGAAGAATTGGCGATCCGCCTCGTGCCATTAATA
caacttcttcgtcttcttgatCGGGATAGTTCGTAGCGTTCCCTCACTCACTCATTTAAAATAAATTCCCTTCCACCTTAGCGCGCAGCCATCCGGCACG
CTCTTCACTCTACTCCTCCCCGCGGCAGCCAACCTGCTACGAGTCTTGCGTCGCTTCCTCATGCGACTGCATCACTCCAAATCGATTGCGAGTGGTCATT
TCACGATCGTATTCACGCACCGCAGTTAAGATCGGCTTCGTCGACCCACGACGGGTCATCGTAGCCTCTCCAGTATACTTTAAACTCGCGGTGGACGCGC
CCGTAGCGCGTACGTCGACCTTTCCGCATGTCCTCAATCCGTTCAACCTCATACTCGCCATCGCTGAGCCTGCGCTCCCAGCTGTCCTCCGGCAAGACAG
CTTCACAGAAGTCAAAGCGATCCGTCTCCTCTCCCACCAGCTCGATCTGGGGCCGATCGGGAAACACCCGCACCAGCTTTAGCTTCGAGACATGCACAAT
GGGGAATAGTCGATACTCTGTCCCACCTGTCTCCAGATGTGCAGCGTGACGATCCACCATCTCGATCACCCGAAACGGCCCATGCCACATATGAGCTAGC
TTGCGCGCATAGCCCTCCTTCACACGATCGAGATATAGCCACACCCGTTCGCCCTTTTCAATCATGTGGGGTCGGACAACTTCGTTATGCCAATCTGCGC
GACCCCGAATCGCTTCACGTAGGCGCTCATTGACTTGCTCCCTCGCTCGTTGATAGTGCTGTTGCACATGATACCGCCATCGACGCGGCTCACTGTCTCG
GCGCCGCGTACAGCCCAGCGGTAGAGATGCCTCCAGCGTTGATCGAGCGTCCCAACCGTGGACCAAATAAAATGGGGTGTCTCCGCGGACGCAATAATGG
GTCGTGTTGATCGCAAACGTTAGACGTTTTGCGTACTCGTCCCAGTCTTGCTGATTCACGTCTGCGACGTACATCTTGAGTGCGCGAGTTAACGTCTGCA
TCATCCGTTCAGCCGTTCCGTTAGCTTGTGGGCGGTACGCCATCGTGGCCTTCTGTTTCTGTCCGACTATCCGGCTGAACGCACGGAAGAAAGCAGACAT
AAATCCGGGTTCTCGATCGTGTCGGATGGCTTCACTGGCTCCGAAGCGTCGAAACACGCACTCCTCGTAATTCTCCGCGATAGTCTGCGCTGTGCGCGAC
GCACTCGCCTTCGCGATCACATAGCCCGAAAACAAGTCGACCCAGATCAACAGCTCGGTGTTCCCTTTGAACGACTTATGCAGCGAAGGGATGTGGTCCA
TCGCCACGATCTGGAACGGGTAAGTGGCTTGCACGTTCCCAGGGGACTCTCCTTGAACAAAGGGGCGCCCCTTCCCAGGCTCACAATCTGTACACTCTCC
CACGTAACGCTGTACACTTCGATACAGGCCTCGCCAGTGAAAGTGCGATCGGATGCGAAGGTACGTCCGCCCGACTCCTTGATGGCCTCCCTCCAGACTG
GCATGATAGTGATGCAGGAAGTCCTGTTGCAGTGTCTCCGGTACTACGAGTCGAGTGACTGCATCGCGATCCCCGTCCTTCGACTTCACGGCGgggcaga
agaagagcaggccactctcgtccagctcgtagTCAACTGCGATCTTGGAACAAGACTTGGCTTCCTCGGCggtcagctcctgcacgtcgcccttcAAGTA
AGCCTTCAGATCAGCGACCCACTTCTCTTCACCCTGCGCTTGTCGTATCCGCTCACCTCTCATGCGTTGCACGATCGCTTCTTGTAGGACTTCAGGCTGT
TGGGGTCGTCGTCTCGCCGATCTCGCGACGGCGCTTGCGCGGACGACCGTGTCGATCGCTTTCGGCTTCAGCAACTCATCCAGTCGGTTGAGAGTGATCA
AGTCTTGGCGATCCTCCTCCAAGGTAATGactgcgccttcttggctTTGTAACGCGGCACTCGCTAACCGATCGGCGCTTTGATTCCAGTCGCGCCTCGA
CCATGATCTCAACTtttccagcgccttctgtcgtaacagcagcaacccggGCGCTTTGTAGTCGATCTCGTCACGCATCTGCCTGATCACCAAGTTGGAA
TCTCCGCAGATGACCAGTCGCCCCCTGTCCAGATCGGACAGGAGATCGAAACACAGCAGCAATCCTCGATATTCGGCTTCATTAACAGTCAGGTCAGCCG
CATGTTCTGACGCCGCTGCGAGGATCGTCCAGTCGGGAAGCTTCCATACGATCGCGCTGTAGGCTCCGGCCTTTCGCTTGACGCTCGCAGATCCATCGAA
GCTGACGACCAGCAGATTCTCATTCAGCTCGaccgtcggcggcagcgtaGTGATCATCTGGCGTGGCTGTTTCTTCGGCGCGATTGCGACCAACGTCTCA
TCGACTTCAGATCGAGGCGTGATGCTTGCTGTGATCGTGCCAAGGATTTCGTCTTCTCCTTTCGCACACTTTCGGATCTCAAGCGTCCATTCGGAAAGCA
ACGCAGCCCAGCGACCGAGTCTGCCGTTCAGTCCAGAGGAGTTCACCAGCCATGCCAGCGTCGAGTGACGAGTCAACATCTTGGTCGCTCGCGTCACCAG
CAACATGTAGCAGACGTTCAAGACACGGAGGAGGGCCAACACTTCTTTGTCGACCATCCCGTGGTTGATCTCGCTCGCCTTCAAGGTACGGCTAGTGAAA
GTCACCGGCCAGTACACGCCATCATGTTCCTGCATCAGCGCCACGGCGATCGCCCATTTGCTGGCGTATACCATCACGACTGGAGTCCGATCCGGGTCGA
AGTGACGGAGAATCGGTGTAGGACCGATCTTTGCCTTCAGCAGAGTAAACGCGATCGTGGATCTCACCCAGCCATCGCTCTCTTCAGGAGATGATCCGAC
GTCCCCGGTCTCTCTGTTCCCAGCCTCGCCATCTGCTCGTCTACGGAATTCATGGAAATTCACCTCTCGCAGCTCGTACAAGATCGCAGCGTAGATCGCA
AAATCTTCGGTGAAGCGGCTGTAGTAGTTcaagctgcccaagaagGACTGCATCGATCGCAGCGTACGTGGGAACGGGAGATTGACCAGGGAATCGAGGT
CCTTCGGATGGGCTTCCAGTCCACCCGCTGACACCTGATGACCCAGGTAACCGACCTTCCGGCGTCCCCAGACACTCTTGACGACACTGATCGAGAGATT
CCACTGTTCGCAAACCTCCAACAGACGTTCGACCTTCGTGCAGAGGGTGTCCCAAGACTCGGCCGTCACCaagatgtcgtcgatgtacGATCGTCGCCCC
AGGACGGACGGCTTCTGATCGGTGTCGGGTTCGCCGTTCTCGAAGACGTCACTCGTCTCCCACAAGTCTGGATCCGCGCTGATCTTCAAGTGTCCGAACA
AAGCATTGTCGATGAGTCCTGAGGCGCGTTCTTCAGTCCGAATGGCATACGCAGCCACTCGAACAGCCCGAATGGAGTGATGAACGCTGAGATCAACCGT
GCCCTCTCGGTCATGGAGACTACCCAGAACCCGCTCGCCATGTCAAGGGAGCAGTACCACAAGATCTTATCCAAGTCATCCAGGAGATTGTTGATCAACG
GCATCGGATACACCGTCAAGCGCGTCAAGCCGTTGACGACTCTGTAATCAATGCAGAGTCGTATATCAACaccgttcttcttgatgatgATCACGATCGG
GGATGCCCATGGTGAGGTCGAGTGCCAGGCGATCCTAGCTGACAGCAGACCCTTGATCAGCGCAGCCAACTTCTCTCGGAATTATGGAGCAACCGGTCGC
ACACGCTGGGCTACTGGAGTGGCACCATCAACGTCGATGTCGCACACGGCACCGCGTGCCGCAGGTGGCAGGGCATTCCCTTTTCCGATCAGCAAgtgcc
gccttcgccagATGATCCGTCGCAGCCGGTCGATCTCTTCCGGGGTATTCAGATCGGAGTCGCCAACCTGAATGTCCTCGATCGTTACTTCTTCGGTCGA
AGCTGCTACCTCGGGCAAGATGACCAAGTTCTGTTCGAGATCTTCTGCAAACAAGCCTCCTCCCTCATGGTAGCAGACTTGTTCTGCCTTAGCTTCCTCC
GAGATCGACTCCCGTGAAGGATCGACATCGGTCTTCGGCAGATCCTGACTTGGCTCGGTCGACTCCTCCTTCCGGATCGAGGTAGGCTCCCGGGCGACTC
GCTCTTCATCCGGCTCTTCACGCTTCAACTCGGCTTCCGGCGTGCCTTCCCGTGTTCCTTCGCAGGGCGATGGTAAGGCGGTCGCTACGGCCACCACTGG
TTTAGGGGCCCCATCCGATCGACTCAGAATTCGTGTCGGCGTCGGATATCGAGGCCGATCGACCAGCGGTTCCGCTGGATCCTCTTCGGGTCCTGGTTCC
TCCTGTCGTTCAGTCATAGCCTCGAATGCAAGGTTCTGCCATTCAGCGTATCTGCGTGATCCGACTGACACAAAACCTCGCATGCGAGGTACGGCGTCTG
GGCCTAACCAAATTCCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCTTCACTCAAGTTTGTGATCCGCAGATACCTAGTTCTGCCTAGGCCCCTGAT
AGGGGTCAGAACCCATCTTGGACCCCGTGCGATCCAGAGCTTCGCGCTAGCCGATCTGCCGCATCGGGTCGGGACCTCCACGGACTCGGCGACTGGCACT
TCGAGATCTTGGTCAAGCGTGACATGCTGGACCGCAGCGCCGTACAGCGGATGCCGTCCTAGCAGCTGAATCCGCACCTCATCAGGGAGACAGAAAGTCC
CATCTGCCAGATCGAGGCGGACTCCGGCTGGTACCATGAAGTCCATGCCGAGTATCGCTTCCTGTTCCGACTGATCGCCAACCCAAGTGTCGAAGTAGTA
CACCATCGATCCAGCCAGCGTGACCTTGATCGTGGTACGTCCAACCGTCATGTATGTGTTTTCTCCGATCCCGACGCATTCTTGTCTCTGACTTTCGTCT
ATGACACACCCAACCTTACGAGCAAAGGTGGTGTCTGTGATCGAGACTTCAGCGCCGGTGTCGAAGAGCAACGTGGCTTTCTCGTTGTTTACCTTGGCGA
CAACTTTGGCTTGCTTGAATCATTTTCCAGGGGCATGATACTTCTAGTACCCTCGTGATTCCCCGGGCTGTAGATCAGGAAACGTTCCGCCCCCAGATCG
CCAAGCCGTCTTGACCTGCCGGATGCTTGGACTTCCCGACGTGTCTCCCTTCTTGGCAGGAGGGACCACTGCTCTGGATCCCGCTGCTTCCAGTAACCTC
GTTGCTCCCCGAGTTGGAGATCCAAGGCTACCTTGACATCGGTCCTGGAGAACTCATCGTCCAGCCGCAGGCTTGAGATTGCCACGGTACGTTTCCCATG
CAGTTCACATGTATTACCGTGTAGATCTGGTCGCTTGCTAACTTGATCTACCGATGTCTTGTCTATGACTGCAAAGATGCAATATCTAGAACGCTCGGCT
CGTATCGGATTCAGACCCGACGAGCGTCCTAGTTTAACATCTTCTCCGCGTTGACTGGCAACATCCCGGCTTGCTTGCTGGGGCTGTACCACTGGCGGAT
CAAGTTGTAGAACCCCTCCATCGGGCACTTGCCGGCATCGTGCAGTTCGCCGCAGGCACGGCACATGAAGAGGCAAATCGGATGA