Description :
From Genome Similarity Track
Location :
contig_87:19888- 21091
Transcript NameFunction/comments
g12388.t1RAW34262.1 hypothetical protein PC110_g9434 [Phytophthora cactorum

Sequence
1203 bases(100 bases per row)
CATTGACAAGCTCAAGCAGCGGAAGCGAGCTCTGTCAACAGTCACTCCGCCGAAAGAGAGCGTGTGGAGTGCTGCGATCGAGTACTTCCGGGTCTTCCAC
AACGGCCTCCAAGTATCGGAGTCATCTGCAGAGGCTTCGATGACAGCTCAGCCTTGCATTCAGCTGGACTTCGTGCGAGCATCCATGGCCCCCGACGTCG
TATCCAATTCAGGCTGTGGTGAAGACGCAGTGATCAGGAGCTGGCAGCGGATCTCATTGTGGTTTCAGGACATCGAGCTGGAGGTGGGGGGCTTGAACAA
GGGGCTGCTTCGGGGACTCTAACCGCCGCTGCTACACTGAGCGCTACCATCACGGAGCGAACGCTGCGCACCGTTTTCCCTCACGTATGGGGGACTAGAA
GTGCCAGTCGTGAGCTTGCCGACAAACTTCTTGGGCAACGGGTTGCCATGCGCGGCTCGGTGCGGTTTGAATGGGACACTGCGTTCGGTCGAATAGCGCG
TGTGGCGAGTGCGTACGACATGCTAACGCCGATGCTTGCTCTGCTGGGGAATTTGGAGGACGTCGCACGAGTGTTCGAGGGGTCACCCATTTCCCCCGAC
TTCCAGCTTAGGCTTGCACACTGAATGTGGTGCGTTGTGTGCACTCTAGCGGGATCTGATGCGACTGAGCGAGCAGTGGGCCAGGCTACGAGTGTCCTGT
TCGAGTCGACCCCGCGAGGATTGTAGACAGTACTCGAGCGTTGCATATCCTTCACCGTGTATTGGGCTGCTATAGCTTCGATACAAGCAACAAGCAGCCA
AGGCAGCAGCACCTGAGCGGTGGTGTTAGTAGAGCAAGAGAAAGGAGTGTATCTGAACGGCGTGCTCTTCGTTGAATCTGATTAAAACTACCACGTCAGG
ACTTGAGACCTCCACTGAAAGTCAGGAGTGATGAGAGCCTTGTCAACACGCACGAGACGTCCTCCAAATTGCCCAGAAGGCGCAGCATTGGAGTCAGCAT
GTCGGCCTGACTGAAGACGCCCTTCACTCGGCCGTACGCGGCATCCCACTCAAAGCGCGTAACGCCGCGCATGACTATCCTTTGGTTCAGCAGCTTTTCC
GCGAGAGCTGCTTCTCCACCCCTTGACAGGTGTGGGAACACGTTGCGCAGGGTTCGCTCAGTAATGGTGACACTTGTTGTGGTACTTGTGACCAGCGAGT
CTG