Description :
From Genome Similarity Track
Location :
contig_96:19887- 21088
Transcript NameFunction/comments
g12771.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
ATTGAGACTTGATCTTGCTCGTGATCCTCGTATCCGTGCAGTTGCGTCTGCAGCAAGTCGTTCTCAAATAGCAACCCATCGCGATCCCGTTCCACCCGAT
CGATCAGCAAGTGCAACTTCTGGTTGTTGTGGCTCAGTTGGGCAATGCGACGACGTGCAAATGCGACCTGATCTTGCATTTCTCGATTGCGGACAATCAG
TTCCTCACAATATCGACGCCAGGGCTTTTCCGCACCATTTTCGACTTCATGCGATGCATCCCAGGGCTGCTCTACCATACCACAATCAGCAAGTGTTTCA
CGTGCAACTGCAGATGCAGTTGGTGTCACGGTCGATGATTCTGCTTGTGTTTCGCCTGACGAGAACGATACTCGAGTTGGCGAGCACCTCGAGTCGCTAT
ACCTGCATTCTCGAACGAGCTCATCAAAAAGCGACGGGTCCATCACTTTCTCTTCATCGGGGGCCTGAAGCTCGAGCGCACTATTGCTGTCAAAGCTTTC
GTCGTACTCGATGCCATCTTCTTCCTCGCTTGATAAATGGACAGCATATCCCCCACCCAACGCTTCATCGTCCCAGTCAACTTGCTGTGCGACTGCGTCA
TGATGACCAGGCGCGTACTGGTCTCTGATATCCACACTGCCAGAAGACAAATCTAGCAGCGGCGACGAGTTAAACGGTGCATACTCGAGCGGGCGACCAA
CAACCCACTCACCCCCGTCACTGCTATCCTCATCGCTCTCACAAAACAAATTTTGTTGTTGGGATATGCCATTTTGCTCCATGCCAGGCCGAAATCGATT
GGATAATCCACTTCCATGACGCTCATAGGCTGGAGTAGGCCCCCCGGAAAGGATCCGGACACTGGGGCGCCTGAAAACGAACGGCGAAACGATGCCTCAT
CGACCATTGCAGGTGCACGCCGCTGTTCCTCCGCTGGAGACTTTACCTGATACTGTCGGAACAAATTGCCTCTGATTCTGCCGAAGGGCCCCCTACCCCA
AGTCAACCCATCTACTGCTGCAGCGCAGCTCTTAGCCATGTCTGGGTCGTCAAATTCAAGAAAGGCATGTCCTTTTGTACGTCCAGTGGAACTTGCCGAT
GGAATAACCACTTGAATAGGGTCGCCAATCATGCAAAACAAATTGCACGACAGAACTTCCATCAGCTCTTCCGTGCGGTCCATTGACACTTTCGGCAGAT
T