Description :
From Genome Similarity Track
Location :
contig_87:19886- 21089
Transcript NameFunction/comments
g12922.t1hypothetical protein

Sequence
1203 bases(100 bases per row)
GACATTGACAAGCTCAAGCAGCGGAAGCGAGCTCTGTCAACAGTCACTCCGCCGAAAGAGAGCGTGTGGAGTGCTGCGATCGAGTACTTCCGGGTCTTCC
ACAACGGCCTCCAAGTATCGGAGTCATCTGCAGAGGCTTCGATGACAGCTCAGCCTTGCATTCAGCTGGACTTCGTGCGAGCATCCATGGCCCCCGACGT
CGTATCCAATTCAGGCTGTGGTGAAGACGCAGTGATCAGGAGCTGGCAGCGGATCTCATTGTGGTTCCAGGACATCGAGCTGGAGGTGGGGGGCTTGAAC
AAGGGGACTGCTTCGGGGACTCTAACCGCCGCTGCTACACTGAGCGCTACCATCACGGAGCGAACGCTGCGCACCGTTTTCCCTCACGTATGGGGGACTA
GAAGTGCCAGTCGTGAGCTTGCCGACAAACTTCTTGGGCAACGGGTTGCCATGCACGGCTCGGTGCGGTTTGAATGGGACACTGCGTTCGGTCGGATAGC
GCGTGTGGCGAGTGCGTACGACATGCTAACGCCGATGCTTGCTCTGCTGGGGAATTTGGAGGACGTCGCACGAGTGTTCGAGGGGTCACCCATTTCCCCC
GACTTCCAGCTTAGGCTTGCACACTGAACGTGGTGCGTTGTGTGCACTCTAGCGGGATCTGATGCGACTGAGCGAGCAGTGGGCCAGGCTACGAGTGTCC
TGTTCGAGTCGACCCCGCGAGGATTGTAGACAGTACTCGAGCGTTGCATATCCTTCACCGTGTATTGGGCTGCTATAGCTTCGATACAAGCAACAAGCAG
CCAAGGCAGCAGCACCTGAGCGGTGGTGTTAGTAGAGCAAGAGAAAGGAGTGTATCTGAACGGCGTGCTCTTCGTTGAATCTGATTAAAACTACCACGTC
AGGACTTGAGACCTCCACTGAAAGTCAGGAGTGATGAGAGCCTTGTCAACACGCACGAGACGTCCTCCAAATTGCCCAGAAGGCGCAGCATTGGAGTCAG
CATGTCGGCCTGACTGAAGACGCCCTTCACTCGGCCGTACGCGGCATCCCACTCAAAGCGCGTAACGCCGCGCATGACTATCCTTTGGTTCAGCAGCTTT
TCCGCGAGAGCTGCTTCTCCACCCCTTGACAGGTGTGGGAACACGTTGCGCAGGGTTCGCTCAGTAATGGTGACACTTGTTGTGGTACTTGTGACCAGCG
AGT