Description :
From Genome Similarity Track
Location :
contig_10:198844- 200282
Transcript NameFunction/comments
g3287.t1OWZ18492.1 hypothetical protein PHMEG_0007412 [Phytophthora megakarya

Sequence
1438 bases(100 bases per row)
GTGACCGGAGCAGCCTTCAATCGTCTCAAGAGTATGGGCGAGATGACCAACTGCTCTTCTACGTTCGCATCTTCAGCCGCATGACGCCCGACGACAAGGT
GGAGTGTGTCAAAATGCACATGGAGGCTGGCGCAGTGACGGGTATGTGTGGAGATGGAGGAAACGACTGTGGGGCGTTGCGTATTGCTCATGCTGGCATC
GCGCTAAGTGATGCGGATGCATCCGTCGTCTCGCCTTTTACCAGCAAACCCAAGACGATTCAGTCGGTGGTTGACATTTGCCGTGAAGGTCGATGCAGCT
TGGCGACGTCGTTTGCGTCGGTCAAGTTCCTCATCATGTACGGCGTCATTGGGTCTACCTTGAGGCTGTTCCAATGGTACAACGCTACTATCCTGTCGGA
ATGGTTCTTCATCCTGGCCGATGGCTTTACTCTCGTGGGTCTCTCATACGTGATCACCCTGTCGCAGCCCCTACCAGATCTGCGCGACCAACGTCCTACA
TCAAGTCTTATCGGGCCATCCACACTGCTCTCAATCCTGGGGCAAGAGGTCATCAACGTCATCTTTTTGCTATCCGGCATCTATATGCTCACCTCCCAGC
GCTGGTACTGCCCGTTCAGCCCCGACAACGTCGACTTGGCCAAGTGGTGGCTACTATCGGACAACCACTTGGCGACAACGCTCTTCTTCACGATCATCAC
ACAACAACAGCTCGCCGCGTGGATCTTCAGCTTTGGTTCCCGCTATCGAGCATCGATCTGGCACAACTATCCGCTGTTGGTGTTGTACGCTGCTCTCGCT
GTACTCGACGTGTATCTCCTGCTTGGTCCACCGGGTACACTCACTGACAAGTTTCGCATCTCGAGCGGTACGAACGTGATGGTGTTGCCGGACATCCCAA
TGCCCCTGGCGTTTCGCTCGCAGTACTTGGCGCTGCTGCTGGGCAATGTGACGGCAGCAATCTGTTCGAATACTACGTGGTGCTCGGGCCGGTGAGAGAC
TGGCTGCGACGCAGGTTTCACAGAGACCATCTCTCTATGCGCACTTGAAAACGTGCCTTGCGTCACATGAGATTTACACCCACCGCCAAAATTCGGGGGT
CAAGAACTGGATCATTAAAACGCACGATGATAGTTGTTTTCTGTATTACTGCATGACAGGCAATTTCGATGATCGTTCGAAACAATAGGCCTTTAGCTTC
GTAATACCTGTACTTCCAGCACCACCTGTCCGTTTCGTACGCTAATGAAGTCGAAAACCTACCACAGTCATTAATCACTCCCGTTCTGCAAGTATGTAGT
GGATACTTCTCCTCAACTCGACAAACCATGAGCGAGGTTAAAACCACAACAGCATAACAAAGAGCGGAGAATCAAGATGGACGGACAGGCGCTGATAGCG
ACTATATAGAAGCAGCTATCTGGCTAGCACTTGTGCAA