Description :
From Genome Similarity Track
Location :
Scaffold_665:1988- 3120
Transcript NameFunction/comments
Phypl_g10181MAP kinase

Sequence
1132 bases(100 bases per row)
agcagcgcgcggacgaggccgcggccgtggccaacgccgccaacaAGCCCAAGTACCTGCCGGCGACGCGCCCCGGCACGCAGTGCTTCATGACGTCCAA
CACGCGGTTCGAGATCCCGTCCAGCTTCGAGTACGTCAAGACGATCGGCTCGGGCGCCTACGGCGTCGTGATCTCCGCCTCGGACGCCACGGCCGGCAAG
AccgtggccatcaagaaTATCCAGCGGGCCTTCGACGACCTCACGGACGCCAAGCGCATCGTGCGCGAGATCAAGCTCATGCGCCACCTGGACCACAAGt
gcgtgctgggcgtggaggaCATCTTCGAgcccgtggcgctggccaagttcgagGACGTGTACATTGTGTCGCAGCTCATGGCCACGGACCTGCACCGCGT
CATCTACTCGCGGCACgcgctctcggacgagcacATCGCGTTCTTCATGTACCAGATGCTGTGCGCCATGAAGTACGTACACTCGGCCAACGTCATCCAC
CGAGACCTGAAGCCGTCgaacgtgctggtgaacGCCAACTGCGAGCTCAAGATCTGCGACTTCGGACTGGCGAGAGGCGTTTTCCCCGAGGAGGAACTCG
AACTGACGGAGTATGTGGTCACGCGCTGGTACCGAGCGCCGGAGATTATGCTGGGCTGCATGAAGTACacgcgcgaggtggacgtCTGGTCCATGGGGTG
CATcttcgccgagatgatgTCGCGCAAGCCGCTTTTCCCAGGACAGGACTAcatcgaccagctgcacTTGATCATGAACGCGCTGGGGGCGCCGAACGAC
CAGGACCTGTACTTCTTGACGAACGCCCGAGCGCGCAAGTTCATGAACGCCGAGTTCCAGAAGCGCGGGCCGAACCCGACGAAGCCGCTGGCGCACATGT
TCACAGACTCGCCGCCCGacgcgctggatctgctgcagaagatgctggtgatCGACCCGAACAATCGGATTAGCGTGGATGACGCGCTTGCACACCCGTA
CTTGGCGTCGATTCGcaacgtggaggacgagacgacggcctcgtccagcttcgacttcgacttcgagaacgagaagctgaccaagcccgtgctgcagaag
ctgatcTGGGATGAGATGAGGCATTTCCACCC