Description :
From Genome Similarity Track
Location :
contig_96:19877- 21078
Transcript NameFunction/comments
g13291.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
AGCTCCTTCATCATTGAGACTTGATCTTGCTCGTGATCCTCGTATCCGTGCAGTTGCGTCTGCAGCAAGTCGTTCTCAAATAGCAACCCATCGCGATCCC
GTTCCACCCGATCGATCAGCAAGTGCAACTTCTGGTTGTTGTGGCTCAGTTGGGCAATGCGGCGACGTGCAAATGCGACTTGATCTTGCATTTCTCGATT
GCGGACAATCAGTTCCTCACAATATCGACGCCAGGGCTTTTCCGCACCATTTTCGACTTCATGCGATGCATCCCAGGGCTGCTCTACCATACCACAATCA
GCTAGTGTTTCACGTGCAACTGCAGATGCAGTTGGTGCCACGGTCGATGATTCTGCTTGTGTTTCGCCTGACGAGAACGATACTCGAGTTGGCGAGCACC
TCGAGTCGCTATACCTGCATTCTCGAACGAGCTCATCAAAAAGCGACGGGTCCATCACTTTCTCTTCATCGGGGGCCTGAAGCTCGAGCGCACTATTGCT
GTCAAAGCTTTCGTCGTACTCGATGCCATCTTCTTCCTCGCTTGATAAATGGACAGCATATCCTCTACCCAACGCTTCATCGTCCCAGTCAACTTGCTGT
GCGACTCCGTCATGATGACCAGGCGCGTACTGCTCTCTGATATCCACACTGCCAGAAGACAAATCTAGCAGCGGCGACGAGTTAAACGGTGCATACTCGA
GCGGGCGACCAACAACCCACTCACCCCCGTCACTGCTATCCTCATCGCTCTCACAAAACAAATTTTGTTGTTGGGATATGCCATTTTGCTCCATGCCAGG
CCGAAATCGATTGGATAATCCACTTCCATGACGCTCATAGGCTGGAGTAGGCCCCCCGGAAAGGATCCGGACACTGGGGCGCCTGAAAACGAACGGCGAA
ACGATGCCTCATCGACCATTGCAGGTGCACGCCGCTGTTCCTCCGCTGGAGACTTTACCTGATACTGCCGGAACAAATTGCCTCTGATTCTGCCGAAAGG
CCCCCTACCCCAAGTCAACCCATCTACTGCTGCAGCGCAGCTCTTAGCCATGTCTGGTTCGTCAAATTCAAGAAAGGCATGTCCTTTTGTACGTCCAGTG
GAACTTGCCGATGGAATAACCACTTGAATAGGGTCGCCAATCATGCAAAACAAATTGCAAGACAGAACTTCCATCAGCTCTTCCGTGCGGTCCATTGACA
C