Description :
From Genome Similarity Track
Location :
contig_47:198736- 219527
Transcript NameFunction/comments
g7848.t1hypothetical protein PHYSODRAFT_496419
g7849.t1eukaryotic translation initiation factor 3 subunit, putative
g7850.t1hypothetical protein PHYSODRAFT_359947
g7851.t1hypothetical protein PHYSODRAFT_492857
g7852.t1hypothetical protein PHYSODRAFT_492063
g7853.t1hypothetical protein
g7854.t1hypothetical protein PHYSODRAFT_488938
g7855.t1hypothetical protein PHYSODRAFT_313188
g7856.t1ABC transporter ABCF family

Sequence
20791 bases(100 bases per row)
TAATGAACGCGAAGAGCGCTGCACTGGCGGAGGCGTTGGTGCCGGCCACGTACGTGCAGCAGGGACTGGATGCTGTACGCGGCCGGGAGAAGCTGGTGAT
GACGCTACTTTCCCAGCGCCGCCTCCCGGACGACGGCTGGGACGACACCAGTGTGGAGCTGCTGCTGCACACGCTCTCGGCCATGGACAGCAACAATTTC
CGGGGCAGCGCCGGCGCCGGCGAGCGCGAGGCGCGCGTCTTCTCTGCGCTGGTGGCTCACCGCCATTTCAACTTGGCGCACGGCGTAGGCAGATCGGGTG
ACGTGGCGGCGGTGCAGCCCAAGGCCGCGGGGTCGTCTCTCATGGTGCAAGTGGCCAACGCCCTGGCCAGAGACGTGCTGCGTCTCGCTGGGATGCGTGC
GGTGCAGGCGGCGCTAGTGCTGCCAGTAGCCACGGGCATGTCGCTTATGCTGGTGTTGCAGCAACTCAAGGAGGCGAAGCCAATTGCGCGCTACGTCATT
TGGCCGCGGATCGACCAAAAGTCCTGCTTCAAGTCTATCCTGGCGGCAGGACTGACACCGCTGGTGTTGGCGAATATTTTGGTGGAGGAGGAAGGAAAGA
AACCAGGAGGATACTTGAAGACGGACCTGGCAGGCATGGCAGCACTCATGGATGAACATGGCAGTGACAGCATCGTGGCTGTGATGAGCACGACGAGCTG
CTTTGCGCCGCGCGCGTACGACAGTGTGCAGGATATTGCCAAGCTTTGTCAGGAACGCAACATTGGTACGGTACAAGTGGGTTGTGGATGCTGGGCTACT
AGCTGATGAAAGAAATTGCTGTGCTGGTTTATTGTTATGGCGTTGAAGCACATGTGATCAACAACGCGTATGGTGTTCAAGCATCCAAGTGCGTCCACCA
AGTGGAAGTAGCTATGCGCACAGGGCGTGTAGATGCCGTGGTGCAGAGTCTCGACAAGAATTTTATGGTCCCCGTAGGTGGAGCAATTGTCTGCTCAACA
TCGCGAGGTTGTTGACCGCGTGGCGAAATTTTACCCGGGGCGAGCTAGTGCCACCCCTACGTTAGACTTCTTCATCACCATGCTTCAGATGGTAAGATTT
ACCCTCGTCTTTGGCTGCTCTCTAACATTATTTGTGTCTGGCTCATGAATCTATCAGGGGAGGAGCGGATATCGACGGCTTCTTGACGAGCGCAAGCAGC
TTGCAGCTTATATGCGCGAGCAGCTTGAAGCATTAGCAGCAGAGGAAGGCGAGCGCGTGCTACACGTCTTCAATAACGAGGTACGGGGATAGCGATTTAC
TTTCAGTTCATCGAGTTTGATAAGTCGACCCGTTTCGTTCGTATGCACAGATATCCTTTGCGCTGACGCTAGGCACATTCTGCTCGAATGCCAAGGATCT
GCAAGAGAAATCTCGGCAGCTTACGTCGCTTGGCGCAATGCTCTTTTCGCGTGGAGTGTCTGGTGCACGGTAAGTTCAAGACTAAGCTTAACGTTGAGTT
GGAATTGCTATCGGTCATCTGACGCATGCATTGCCTCAGAGTGGTGTCGTGTCTCGATAGCAAGACAATAGCTGGACACAACTTCAATTCATTTGGAGCG
CACCACGACGCATTTCCCGTGGCCTACGTTACTTTTGCCTGCGCGTTAGGCATGCAACAAAACGAGGTCGATCTGCTCGTCACGAAACTGCGCAAGACGA
TCCACGAGTGGAGAGCGAAGCAGAGCAGGTCAATGGCTGCCGTATAACGTCGCCACTCACCTCAAGTACATGTAGTTCAGCACTGGAGAACGGAAAGCAG
TCAAAATGTTGACTACTGTGTCTATAAATCTGTTTCCTGACGTGCTATCTTTTCCTATTCTCTCTCCTTTCACTAACACAGCAGTCGCACTGAATTGCCT
AGTGCTTCTTACTGCCGCTCTTCGTCTTCCGAGTTTTTTTCTTGGCCGCAGGCGGGGATCCTGCCTGTTGGTCAGCCTCCGTCTTGAACTCAAGCTCTCC
AAGCAACTCGTTGGCAATGGCATCAGCAGCCGCAGCGGCATCCCCTTCACGGCGGCCCTTCGCGCCCTCCACAGCCTTCTCAGTGAATGCAGCCATAAAC
TTGGCCGAATCGATCACACGCGGATCTTCCTCACCGTATGCCTCCTTGAAGAGCGAGTACACCTTCTTTTCGTACGTGAGGGCCTCGCGGAAGCCACCGG
CAAGTCCACAAGCCATAGCCATCTGGTGGAGAACATTCGCAGCCTGGTTGCGGTCAAGCTCGCCGCGTCGGAGAGACTCGCGGTGGCACATCAGTGCCAA
CGTGATCTGCCCCACATCTTGGCACATCATACCCATCTTAAAGTAGAGCGAGCTGATCTCAGGGAAGTGAGGTCCGCAACAGAACTCCAGCAGGTAAATG
GCACGGCGAATGTGGCACAGCCAAATCCGTTTGGGCATTGGCGTGCAGGAATAACGCAGTTGGCGTGTGCGAAGGCCGTGTCGTGGTAGTCGATGCCCTG
AAGCTGTGTGTACAGAGCGAGCGCTCGCTGCTGCTGTGCGATAGCACCGACAACGTCGCCAGCGTGATAGAGGACAGTAGCGAGCGACGAGCTGCAGAGA
GCTGCATCCTCGTGGGCGGCACCACACACCTGGAAGAGCAGAGATGAAGCCTCCTGGAGGAACTCGTACGCACTCGACAGCGCTCCTTGGCCCAAGTGCT
GGCGACCACGCTCAGGAGCTGCTTGGCCTGCGCAACGGGTGCGCAGGCAGCGAGTGCTTCACGACCGGCACCACACCAGTGATGTCATCCAGGCTAATCG
GCGTGGCGCACGACGATGAGAAGTCGTAGTTGCGGCTCACCACACGCAGCCCCAGACGCTGGCACAGACGTCGCAGCAAGACTATTCTGTGCGCGCGGCC
CACTGGAAAGGTGGCGTCATCAGCACTGGCCTCGCCACGGCCAGGACCCCACAGGGCCAACTTGTAGTCAAATCGGGCCTTAATCTCCTTGTCAATGCGA
GACCAAAGCGTGTTAGCATCCAACGACGCCGTCGTAGTAGCAGCGGCATCATCAGTCTCGAAGACATCCTTCTTGTCCGCAACAGCAGAAGTCGATCCAA
GAATGCCGTTCAGGAGCTTCACAATCGCCGATCCTGGGGCAGCACGAATGGAGTCGTTGGAGTTCAGAACATCAGCCAGGATGTGTTTGGCAACGCGAGA
TATCATTTCCACCTCGAGCACTTCCAGAAGTACTTGGAGATACCGCCAATCGCCTCCAGCTTCTTGGCAAGCAAGCCAGACGACCCAGGTAACGCATATT
GATGCCGCAAGAGTGCATCAGCTGCGTGAGCGAGTAGCCATCGCAGGGGCGATAGCGCCACGGCGCACGTCGGCTACAAACGCTGGCACAACAATCCTCT
GCAGATACTCAGCAGCATCTTTCGCCGCTGTTTCATCAGCCTCGAGCTGCTCCGCATTCGTTGAAGCCGCATAATCCATGAAGACGTTCGGGTTCAAGAG
CACCGGAGGAACCGCAGCCGTCTCCTCTTCCTCATCGGCCTCCTCAGTCTCCTTCTTCTCGGACGTAGCATCTTCCTTCTTCTCAGTGTCAGCCTCAGCA
CCATTCTCCTTATTCTCATTTGCTTCCTCCGCCTTCTTCGCTTCCTTTGCTGCAATGCGAGCCTCACGGTTGACACGGCGGGCTTGGTTCTGTTTCCAAA
GCGAGTACAACTGGACCAGTTCCGGGCGCAGCAGAGCCGCGTAGCCTTCGTCATTGCGAGTGAAGCACAATCCATCTTCTTCGGACGGAATAGACTTCTC
CTCCTGTTTCTTTAGTGCAGTGTCGCGGCTCTTATAAAATGTCCAATCCTTCGGCGTGATGCGGACCAGATCCAGGACATACAGACGGCCATCAGAGCCC
TGGATACCCTTGGCCTCCACAGCACCACAGATGGTTGCCACATCGGTGCTTGCCTCACCACCGCTACCAGGTGCAACACCAAGAGCCTCCTGTTCCTTCT
CAACGGCCAGGTCTTCTTCGGTCTTACCAAGAGGCTTAATGCTACGCTCTGCAATGTGCAGCTTCTCGCCCGCCTCGAGCATGAGCTTGTGCATCTTGTT
GTTGGCAGCAATGGTCTTTCCGTGGTCCACAGAGCCGTACACCAGCTTAGAAGCTGCATCTCCCATCAGGATGCCCGGGATAATACTCTGGGCAATAACA
CGGACACCAAGGTAGTCCACAACCGTCGTGGCCAGGGTGTGGAGACCACGGACATCCGCCTCGTTGAACGCCTTCACACCTTGCAGGTCTCGGTTGGCAG
CCGAGTAGGCGTTCTCCTCTCCTCCAGCGGCATCTTTGGTGGAGTTGCCGTCGATCGACATCGAGAAGAAAATGTTGTTGAAAACGTATACGTGCGCACT
CTTGTCGTCCATGGGGTTGATAGGAGGAATGTGTCCCTCAACGATAGCAACCGAGCCCTGGGTTGCTGCTTCCACGAACTCCGTCACAATCTTGTACATG
ACACGAGCGCGCACAATTTCGTCCTTCAGCGAGTCGGTCGGCAGCTCACGGCAGCATTGATACTCCTCGTTCCAGTCACGCAGCACGCCACGCTCATCCA
TGCCGAAGGACGCGCAAAGTTCGTCTTCAGCGCGATTGAGGTCGTACGTGTGCTCCTCAGTCGCCGTGGCAGCAGGGGTGTTCCACGGCAGCTTGCCACC
CAAGCTTGATCCAGCCGCCACCATCCACTCGATAGAAGAAGGCCCCTCCTTCGCCAGAGAAGCAGCCTTAGCAAGGAGAGCAGCGTACGACTCCCTGAAC
TTCGGCGATACGGAGCTCAACACATCCACCAGCAGATGCGCGTGGGCCGCAGCGGTCTTGTGCGGACGCGGGTCGAACTTGGTGGCCGTCGAGCGGTTCA
CAAAGAACCCATTGACGTGCGCCGTGATGTGGTAGCGCGTGTTATCGCCAGCAACCACCACCTCCAGGTAGAGCAAGTCACCCGCGAGTTTGCGGGGTCC
TGGCGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGACACAGGTAGGGAGTTTGGCATCCTGCTGCTTCTGCTCCGGCTCCTTGTGTTGGTTGGCCTCG
TTCTGCTTCTGCTTCAGCTGGTTCTTCTTCCCTTTCTTCGCCTTCTTCTGGTCCTTGGCCGGCGTTGGCTCCGCGTCCTCCTGCGCGACGGGGGTTGGGA
AGGCGTAGAACTCGGCAGCTCGGGTTTCACTGGGACTTCGACCCCCTCGAGCTTGTGGTGGATCTCGCGCAGACGCTTGAGCTGCTTTTCGGACATCTCC
TTCAGCGCCTTGTCGTCCGGCTCCTCATTACTGGTATCGGTCACACCTTCCGGCTGAGCCTCGGGCTCCGTGGCTACCTGGGGGATGGGCGGATTGTTTA
GCACGTCCCGGAAGCGACGCACATGGCCGCGCACCTTGCGGGCGTCGAACTTGTCCAGTGCCATGCGCAGCGTCACGCCGTCCGCCACACTCTCGTACTC
GCCCAGCTCCACAAAGTCATTGAGCGGCTGCCAGGAGCCGTCCGCCGAGCTCTTGGCCTCCAGGTGGTAGCTCGTGTAGCATGCGAGCGCTGGGAACTCG
GCGATGAGCTGGCGCAGAGACACGACCGTGTCCGAGGCCCCCACGCTTTCGAGCCGCACGCACTGGCCGCTCTTGGCGGCGGGAGGCGCCACCAGCACAC
TGAAGGTTTGCTCTTCCAGGGCCAGGAGCTCTGCCGGCTGCTGCTCTGCCGGCTGCTCGACGGTGTCGCTGCTGCCCATGATGCGTGGAATCTGCTTGCT
TTACGGGGCTGTCGTTGCGATCTGAGCAATTGTGTGGTGCGTGGGCAAGACCGAAAAGGCTGATGGACCATTGCAAAGGGGCAATGGCAAGACAGTCATT
TACCGAATTTGTTCAAGAATAAGTAGTGCCTCGTGCTGGTCCGATAGCAAATGTCAGTCAAACGGGTTTGACGGGTATGCTATATCAGAGGCTTGAAGTT
GTCTTTCATCTTCAGATTGTGGCAAATCACTTGGTGTTTGTAAGAGATCAGGCGAAGTACGTCATGTATCTGGCAGACGCACCGGAAAAGCCCACCGAGA
ATGGAGAACATCTTGGCACTGGAGCTGTAACGAGCACCACGTCAAGCCACATCTGGGCACTGGAGCTGCAACGAGCACCCCGTCAAGCCCGCATGCCTCC
GTTCACCCAGCATGAACAGATTTGCATCAACCACCAGCACCAGCGCTTTTGTACCAGTTTTGATGGATACGTTGGTGTGTGCCACACACAGACATGCTCA
TCCGAGCCCTTCGCCGCAGCTTCCTGGCGTCCGGACCTACCTCGTTGTCGCGTCGCTCACTTGCGCCCTTCACCTGCCGCACCATGAGTTCCGATGAGCG
CGCCCAGGCCGACGCTGCGGCCGCCTCGGGTGCTGCCTCCGCCGTGGGCGAGACCATCTTCGACAAGATCATCAACGGGCAGATCCCGGCCAAGATCGCG
TACGAAGACGCGCAGTGTCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCGTGCACATCCTGCTCATCCCCAAGAAGCGCGACGGCCTCACGCAGCTCG
CGCACGCCGAGGAGCGCCACGAAGCCGTGCTAGGCCACCTGCTGTACACTGCCAATCTGGTCGCCAAGCAGCAGAACCTGGACAAGGGCTTCCGCATCGT
CATCAACGATGGAGAGGACGGCTGCCAATCGGTCTTCCACCTGCACCTGCACCTTCTTGGGGACGCAAGCTGGGCTGGCCTCCTGGATAAACGAGGACAT
CGGCCGCCGCCCTGTGTCAATGAGGGCCCATGGACCTCTGCGAATTATTCAGGTACAGGCGTGTATGTTTGAGGTAACCAATGCTACGATGCTGGCCTAC
TACGCGTAGTTACTTGGTCAACGTTATGGCGGTCTTTGAGGGCGCCACTTGGTTGTCTGGGCGGTCTATCCTCGGCCGCTGATCTCTTTGAGGAATTGAT
CCAGGAACGTCTCCATGAACGCGTGGCGCTCTTCTGCCAAGCGCTTGCCGGCGTTGGTCTTCATCATGCCGCGGAGCTTCAGCAGTTTCTGCAATGACAA
CAAAGTTCCCAGACGTTAGACAAGAGCACCACCGGAATTAGACAGCGACGTACCTCGTAAAAGTGGTTGATCGTGGTGTTGGGGCGGTTCGGGTCCATGT
ACTGCTCCTTGGTCATGTCGTCAATTGGAGGCACATCCGGGTCGTACAGCGGCCGCAGCTTGTGCCCTCCGAACGTGAAGCACCGTGCGATTCCAATGGC
TCCAATCGCATCCTGCACGTCAGAAGCGGAAACGTTGTCAATCAGCACAAATGTCCGTTGCTGTTAGTGGACAGATAACCTACCAGTCGGTCGGCATCCT
GGACGCAGCCATATTCGATCGAGTACGATCGCTGGCAACACCAAGCAACGAACAGCATTAGCCACATGACTCCCATCCAACCAAACCATCGCCACTCAAA
AGGTAGCATACCGAGCCGCTGCCAGCCAGCTCCTCCTTGAACCCCATGCTGTCAATGATAGTCATCACGCGCTCAATCTTGTCGCGGGGCACGCTCTCCG
ACTGCAAGAAAGCCACCGCGCGCTTCGTGGGCTTGTCCTTGTCGCTCTGGTATTTCCAGTCGTCGATATCGTGCAGCAGCGCCGCCAAGTCCACGATCTC
CAGACTCTCCGCTGGCACTCGCTGTGTGGCACATGATGCACCCGTCAGCAACAGTCACGCGCTCCCAATCCTCCGCTGCAGCAAACCTCCTCCCTGGCCA
GCGTCCTCGCCACCGTCCACACGCGCTCGATGTGGCGCCAGTCGTGGGACGCGTCGTTGCTCTTGAGCTGCTGCTCCACGAACGCCGCTGTGCGCTGCAC
CAATCGAGAGGTAGCCATCCTGGTCCGAGGCAAATTGCGCAATGAACAAGACAAAGCACAACCATCAGCTGTCGTACAGCGCCGCCACTTGGGGTTCGAG
TTGCTGCTGCTTGGCGCGAACATTGCTCGTCTCTGATTGGCTAACTCGCACACCTTCAACATTGAAACTCCCCGCAGTTCCCCAAGAGGCAGCACCATGA
GCAGCTCCCGTAGCCGGGGCCCGACCCATGCGGCGGTGACCGCCAAGAGCGAGCGGCCCCGCAAGATCACGGCCAAGGCGGAGAGCTGGACGCTTACATG
GAGAAGCTCTACGACGACGACGTCGAGTCTAAGCTGGACGGGGCCAAGATGATTCTGCAGCTGGCCGAGTTCGCCGGCAACATCGAGGCACTCGTGCAGA
ACGAGTCGCTCATGGTGCGTTCGGGTGGTAATAGCGTACTAGTTGCGCTGCTGATTGCTGTGTTGTTGCTTAGAGCCTGCTGTCGCGCGTTCTGAACGAC
GACTACAAGAAGAGCTATGACTTTTCGCTTACCATGATGCGCATCTTCTGGTGCTTCTCCAACTTCTTGCAGCTGCATCCGTGCTGGGCAACTACCGCAT
CGGAGCCATCACACTCAAGATCGTCGAATTCGAGCTCAAGCGCCACCAGCTCCGGCAAGAAGAGGAGAAACTTCTCGAGAGTGCAGTCAACGGAGCCCCA
ACAAAGGGAGAATCAACTGACGGCATCCTAGCGAAACTAGACCGCGAGAAGAAACGCAACAAGAAGCGTATGAAGAAACAGGACCAACTACTGTGAGAAT
CCTTCGATGGCAGCGGGATATTTGTGACTGACTCGAAAATTCGTTCTTGTAGCAATGTTTGCTTCAGCGTGTTGCTCAACTTGGCCGAGGACATTCACAC
GGAGCGCAAAATGGTCAAGCGCAAGATTGTGTTTTTCCTGACCAAGGTTCGTGTCTGTATTTAAGCTGCTGGCCGGCTTGGATGTCAAACGTTTGTAACT
TACATGGTTTATTTGCTGCGTAGCTGCTGGATCGCGTGGCTCCTGACTTGGTTATCCTTACGATCACTTTCCTCAAGAAGCTGAGCATTTTTGAGGAGAA
CAAGGACGCAATGGTGGAGCTTACCGTCGTGGAGAAACTCGTTCGCTATCTCAACTGCAACCACGACAAAACAATCCAGACGGCACTCAAGCTGCTGTTT
AACCTTTCTTTCGATCCAGCTATCCGTGAAGTGCTGGTGCGGAATAGCCTTATTCCAAAACTTGTGGAGCTACTCAAGAAACCTCCCTTTCGTGCATTGT
CACTGCGGATTCTCTATCACCTAAGTATCGATGATCGATGCAAGTCCATGTTCACGTACACGGAGGCTATCCCGATTGTCATGCAACTCGTGATAAATTT
TCCGCAGAACATCGTGGCAAAAGAGCTGGCTGCTCTGGCGGTGAACCTCAGCCACAATGCGCGCAACGCCGAGCTCATGTGCCAGAACCGCGGTCTAGAA
GCACTTGCAACACGCGTGTTCCGCACGCGTGACCCGCTCCTGATGAAGGTGATCCGAAACATTTCACTTTGGTCATATACGCTACAAGAAGACTTGGTCA
GCGATAAGGCGTATAAGTACCGTGGTATGTGGGCTCCATTCGTGGTTCCGTTATCGAGCTGTGTATCAACACCGACAACCACGGACTTTTCGATCGAAGT
TCTGGCAACGCTAGCCAACATGACACCTAGTGATTTGCCTCCAAAGACATCATGGACAAATTGGTGACGGATCAATCGTTAATCCCTTTCCTCAACAAAA
TGCTGGTGCCAGGCTTTTCGCAAGACGATATGATTCTTGAAGTCGTGCTTTTCGTTAGTGCACTCGCGCTGGAACCGAAGTGTGCTCCTCTCTTATCGTC
ATCTCGGCTGGTGCGCACGTTCCACTCGCTGTTCCAAGAGAAGCAACACGATAACGAGCTCACATTGCAGTTGCTTTACGCGTTCTACCGCATGCTTCGC
CACCCCGAAACCTTTGAGGAAATTCTCTTTGGAGTAGGGTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCATCAAGCATTGAAGTCCGCCGGATGTGCG
ACGTGCTCATGGACTTGATTCTCGACCACGATCTCAATGACGGTGCCATCGGCGACTTTGGACACCTCATTCGGCAACGCAGGTTTGAAATCCACAACGC
TGAGTATCTCGAAATGATCCATGCAGAAGCACAAAATGCAAACTACCGCAAGCACCACGGAATGGATGACAATGGTGGCAAGGAGGACGACGATGATAAC
TAAGCGGCCAGAGTATCATCATCCGGAACCAGTCAAACTCATTAAAAGACCGCGTATACTTCTGTAGCCAGACTTAAACCTTTAATCCTTGCGGTAAACT
GTTCCACGCAGTATTCTTGCCTGCAACGATCCTACTTCACAAACTCAACTAATCCTTTTCCTCGTCAGGAACCCAACCACGCTCTTCCGGTCAATGCCAA
AGCGAGGCAGTGCCTTTTCCGGCCAATACGTATTGTCCTCGCTGTTAATGGACGCCCCCGGTGGAATCACGTACATGCTGTACGGACAATTTGGTGATAT
GGTCATTGCAAGCGCGCGAGAGTTGTGTTTCCTTTTGTCCGAGTAGCGAACGAGTTGCCGCACGAATTTCCAATGGTCATACGCCGACTCTAGACAAAAA
AATGTCATAGCCGATTCATGGAGATTACGCACTTCTGTCTCCAGTCTTTCCATCCCGACAGTTCCTCGCTGCGTCACCACTATACTTGGGCTCTCGGGAA
ATTCTTCAGGGATCATTCCGTCTCGCGTACGGCACCAGAAGGCATCCACGCGAAACTCATGGTAAGTGTTGGTATCGGATGCGTCCTGAATCTGGATACA
GCATGACCAAGCGACGGAGTTCCGGATCATTGGATTGTCGATCTCCATCTTTTGATCTTCTCCCTCGGGAAGCTTTGAATCAAGGCCACAATCAATCAAA
TCAATGAAAAACTGTGCTGCTCTCCACTCAGCCAAGCGACGGGCCTCCGCTTCTGTTTTCCATGTAGCTCTACAGAGAGCATGGCCATCGACTCGAACGA
CACAGTGCACACCAGGGGGTGAGCGAGAATCTCTGCCAAACGAAGCACGAGGAGGATCTTCCACAGCAGTTGTTATCTGTTGCGAAGCACACTTACGGTT
AGTTCGAACGAGTAGCATTCATAGCGAAGAAATACACGTACACTGGCGATGCCTGACAGCTTTAGAGCTCGAAAGGAATCCTCAGATGAAACATAGGCCA
GAGATTTCACGTCCAGAAAATGAAGAAGTTGAGCCCAGATCGAGCGGATCCTGTTTAGCCTGTCCAACATGCCATCGACAGCAGCATTACAAGCTTCAGG
CTTCGCCATTTTCGATGCTTTGAAGCGGATGACGTCGTTGACATCAACAAGAACTTCAAATACGCCTTCTCGCAGGCGTTCCATGCTGATATTTGCCGTG
ACATTGGGGACAATTCTTCTGTGTTCAGCCCCCCGGTACTTCAGCGATGCTCGAAGTCTGTTAATACCAGCGCATAATTCATCTGTTGGTGTAAACAGAC
TTCGAATTGCGGCGCGAAATTTGCCATCGTCGGTGTTCTCGCTCTCAGACACCTCATTATAGTTTTTTTTCATTTCATTCTCAAAGGCTGCCTCATCTGC
TGCAGCGCTGACATCTTGTGAGGCTTTGACTGCGGACGGATCCCAGTCATCATCAAACCCACCGTCTGAATAGTTATCGTAGTCGTCGTCGTCCATCTCA
TCGTCGCTGCACAATACGAGATTAGACTTCTTCACTTGAGTTGTTGTCGGGGGCGAGATTGGTTCGTTCCTGTGGATGTCGATGCTGGTGCTGCATTTGT
TGTGTTGTTGCTTCCATTTGAGGAGCACGACGGGGTAGATACGGATATCATCTTGTTCAATGATTGCAGGATGTCGCGCCATTTTTCATTTGCAGACCGT
TTGGCATCTTTCGCGTTCAGGCATGCTGTCGAAATGGCCAGTGTGTTGCGCACTCGAATGAAATACATGTACAAGGGCGGAACGAGCTTTTCCGACGCCG
AAACCTGAAAGGACCTTGTGTTAGTCTCCCTTAGGGCCAACAATGCAGTACTTCGAAGTAGTTAGCCAGCCGTACCTTGTCATGATTCTTTGCTTGCGTT
TCGTTGCCTGCCATCAAAGTTGTGGGCGTTTCAATTAGTCGTTCGTTGTACGTGACGAGCAACGCTTTCCACGTTTCAATCATCCCATCCAGTGTGTTTA
TCAAAACAGAAATTGCCTTGTCCTTCGCGATTTCAATCGACGACCCTTCTCCTTTTGCTCGACCACGCCTTCGGATGCAGAAAGCACACAGCTAACAAGA
CCACTGTTTTCCTTCGTAGCAATCCGGCGGATCTGGAATGCAATGTAGACATCACACTAAGTAAAACGTACTAAACTATACGAAGCAGGAAAAATACCTT
CCGATACATACCGATAGATTGGACGAAAGCTGAATAGTTTCGGACTGCACACGCAAATTCCACACGATCGATCTTACAGTTTGCTCGGTCCTCTCCCGAT
CTCGAAATAGGAACATCAGAAGTTCCTGGTAAGCGTCAGATTTTGCTTTTGAGGCTTCATCTTCGGAACGAGGGGGTCCATCACTATTGGCCTGCGAGCC
GCTTCGATCTTCAATGAAGATGTTTGCTTCTGCTTCGGCACCAGAGATTCTCTCAGCTCTGTTTTCGGAATATTTCCTTTCAGGAAGTGGTGGTATTTCG
GATTCTGGGGCTGAGTACTCCAGTCGGGGACGAGGAGCACCACGCTCGTCCTCGTAAGTGTCATTTGCATTTGGTGCGTAGTGTCGCTTTCGTAAAATGC
CCATAGACCTTAGCTCAGCATCTCTCGAGCCGACATTTTCGCTGCTCACGCTGTTTTCGCGCATGGAATCCACCTCGCTGTGGTTATAATATGGCTGGGC
ATCTTCAGTCGCGCTTGGCTCATAACTGCTGGTCCACGCATCTCCATGGTGGGGTTGAACACTTTCTATCTTGGTCGGTTCAAAGTCGTTCGCATGGTGC
TCTGCGCGGTCGAGCATCAGACTCTCCTCGTGCTGATCAATTAATTCCATCAGGAACAGCATCAGTGCGTCAACTGTCTCACTTTTAACGCTGGGTAAAG
ATGAACCACGCCTCCAAACGAGTGGGAGCTCTTGGATTAGAGCAACTACGTCATAGTTAGTATCGTTATCAGTGGGCTCTGCAGTGGGTTTCTCGTACAG
CTGCACAATCCAATAACTTATCAGTCTAATATCAACATGCCAGCCAAGCAAATGTGCGTACCCGAACAATTTTCTTCGAGATCAGATAGTTGAAAGATGC
ATCTTTCACCCTTCTGGTATCATTCGCGATACAGAGGCCGAATTGAGACTTCAGATGCAGCAGCATGTCGCCATACAGTCTTCGATGTTCAACTACAGCC
CTTGTAAGCTGCGACAAAGCTCGGATAGTTGCATCACGATCGACAGATGCAGTGCACTCAAATGACAAATTTCCTAGTCGAACCCGAGCAATGTACTGGG
CCGAATCAACCATCCGCAACTCTCGCCGAAGCTGCGCGGAAACAACCGTCAACCAAAGTATTCAGGGAATGAGGAAAACAGAGAGCTTACCTTGAGTCCC
GCAGCCAAGATAAACTCTTTACTCATTGCTGACAGCGACACAGTTTGGACAGCTTTTCCTAGTCCTTGAAGCGATGACACGAGGTCGATATTAGGGCCAA
CCAAAGCAAGGAGGTACGATCGGCCCTCCTCAACACCGAAAGTTCTCTGCTTGGCGGGGATACTTTTTGTCACTCTGTTGGCCCTGCTGAGTGGGTGGAG
GAGGTAGAGGTGCTGGAGTCGGTGTCGGAGCTGAAGCTCTAGCGGCCTCAGAGACTGGCTCAGTCACGCTTACATGGATCGGCGCGGCATCTATAGCAAA
AGTCACCCGTTTCTTCGGCGCAGTCCGTGCGGCAAATTGAGAACCTTTGTGGCGCAGTATCGACGTAGTGCTCGGTGCACCGGCAGGGTTGCTGTCATAG
CTCTCGTCGATCGTATCGACTGCCATGTCCACAGGTTCCTCAGCCATGTCCACGTCCTTGTCTTGTCCTTGTTTGCTCCGTTGCCCACCCCCTGCTCACG
CATCAATTCCGCATACCACTTCCGGAATTTGTCGGCGAATTGGAACTTCCTGTCCTCCATCAACGTGTTCCTCATGTCTCCCGTCATGATCTTCACGTAC
ATCAGCAGCTTCTTGGCCGAGTGTAAGCGCTGCACTGCCACTCGGTCCTGTCTGATCAGCCCTCGTAGCGTTCAGCCAACTGCTGGTGGTGCGTGTCCAT
CTCGTCCAGGAGGCGGAGAACGCGACCAGGCGTGCGTCCCTGTCTCGGATCGTCCCGAGCCGCCGCCCCCATGCGTACGAAGCGCAGCACAACCGTCCTC
CTCGTCGCCTTGTCCTGCTCCTGCTTAATGTGAACTTGTGCCCCAATAGCAGCCACGTCCTTATGCAGCTGCTTGAGTTTCCTGGGGCACAAGAGGAAGT
CCTCGATGCCCATTCCCACGAAATAGTCGTCCGGTTCCACGGTGCAGATGGGCTCCAGGGCAGCGCATTTGCCCGCCACTTTGTCCTCGAACGCCATGGG
AAACTGCGGCGGCGCTGTCTTCTGCACTTGGAACAGGTGCGAGCTCATGATGGCGGTCACTGACACGCCCATGCTCGCGAGCTGCAGGTCACCAACGGGC
CCACGGGGAAGCGAGTAGTGCACCTCGAAGGCGCGGCCTAGTGACAGCAGCTTGCGAGCAGCGAGCGTCGTCTCCACGCGCCACAGACGCACGCTCATGT
CGAACGCCAGGTCTTGGTTGAGCTCGGGAAGCGGCTCCATGCTGTCCGCCCAGGGCGCCATGTTCCAGGCTCTGCCGACAACTGGATGTCACTGTGTGTG
GCACTACGGAATGACTGGATTTCACTATACCAAGAGGGACAAAGGGTGACAATGCTCGCGGCTTGTGTGTGTATTACTTATGTTAATACTGTCTACTCCA
TGAGGAAGATGCGGCTGGCAACGTCGCCGACGAGCCAGTCGATGCCGTCCACGAGGCCGTCGCCAGTGACGGCGCTGCACGAGACGATACTCCAGTGGCG
GGTGGAAAACTGAGCCGACCGCAGCCCCAAAGCGTCTGCGATCTCCGCGGAGGAGAGAGCGCCAGGCAGGTCCTGCTTGTTGGCAAAGATGAGCAGCGTA
GCGCCTGCTAGTTTCTGCAAATACGGTAGCAGCCAGCAGTCAGAGAAGCAGCAACTTCAGGAGGATCTTATGAACGCACCTCTTGCGTCAGCAGACTCGA
GAGCTCGCGCTTGCAGTCTTCGAGTCGCCGTCGATCGGCGCTGTCCACGACCCACACGAGGCCATCCGTCTGTCGAAGCACACATCCACTGTAAGCTTCC
TTTATACTTCAGTGTATACAGCCTGCCGCTTCCAGACCTGCTCGAAGTAGTTTCTCCAGTACGAGCGAATCGTTTGCTGTCCGCCGACGTCCCAGACATT
CAACTTGAAGCTGGCAGTGACAGCAACACAGCGACCATGAACCTCGCACTTGCACAGAACCCACCGCGCACACTCACTCTTTGTACTCAAGTGTCTGGAT
GTCGAACCCCAGCGTTGGAGAGATCTCGGTGATGTCCTGGCCCATGAACTTCTTCAGGATTGTCGTCTTGCCGGCGTTGTCCAAGCCACTACAGCAACAG
CAAGCGCGTCAGCCCCAGTAAACGACCTCTAGCACTAAGAGTGAAGATAGCAACGCACAGCATAAGGACTCGGATCTCCTTCTCCTTCTCCTTGACCTTC
TTGAGGATACTCAGCAGCCCCATGATGCGATTCGCCTTGGTGATCTAAAGTAAATTGCCGAACGGGAAGTAATTTATTTGTAAACTACCGTCACGAAAGG
GCATGAAACGACGCTTACGTTAGGTAGTTCAAGCGCAGCGCAATTGCAGTTAGTACTACGTAGTCGATACGCCATGACCAAAGCCGCCCCACCTAGACGC
TTACTGCTGAAGAAGTGCGATGGGAACCAGGAGGACGTAAACGCTTTCGATCCGAGCAGTCGGTCGACCAAGGCGCATTTCCCCCTGCAACAGGAGCAGT
CTTCAAAAGAAGATGCAGATCCGTTCGAGAGCAGAAGAGCTTGCAGACACACGTCATTGGAAGAGCTACTAGATCTGGAACTGGATTTGATCCTGCCTGT
CACTGCAATTCCAGCTCCGACGAGCAACCAGTTGCCTGTTTGTGCTGCAAACGAGGAGCTGGAGGCCGACGTCGACTCCGTCTCACTGGAGCTGCTGGTA
CGAACGAGCGAGCAACCATAGTCGTAAATGACAACTCACATGACTCGTATGTGTTGATGATGCAGGCGATGCAGAGCCCACACGGCGAGAATCAGCAATG
GCTAAGCGAAGAAGACGAGCAAGACGCGAATTCCGTGCCAAGCGCGATCACCGTTCGACCAGAGGAACAGTCTCCACGGCCTACTGTGAAAGGAGCGTCG
GCTTCTAGAAAACCGATGGCGCTTCATCTCGTGTCGCCGACAGCGTTTGTACCATCGTTCCCTCCATCACCGAGCCAGTCGTCGACAGACGAGGACTATG
GTTTAGCATCGCCGATGGCGCTGCCAGACACACCTTCACAGTCTCAATCAGGGATCACTTTAACCTGGGACCTTGCACCAACCTCTCCTACCTACGAAGA
TACTTATACAAGAGCAGGAACTTCTCGTGGATTCGCACAGTCCAAGAGCGTCCAAAGACCAGAGCGTCGAACCCCTCGATTTTCAGCTGCAGCTAGAGCT
GCAACACCAAACCCACGAAACCACGGAAGCTATGCACCGGACCGAGCTACGGCACGGATAACACGGTCTGCACTTCCAACGCTACCGGAAGGCCGAGGCA
AGGCTAGGCATGGCGGAATCTACTCATTGTTACTCAAGAATAAATCTGGGAAACAGGAGCCGATGCTCGTTGAGGACGCACACAATTCCGACGGTACGCT
GCTGTGGTTTGATGGTACAGAGGAAATTTTTGGTACTGATTTCTATCCCTCAGGTATGACTCAGGCGCCTTCCGTTTCTAAGGCGAGTGCGTGCAAGCAA
AAAACGGAGGTATCTACAAAATGCTGAGAAATTATAAATAATTTCTCATGTTATACACGGTTCTCTCCGTTTCTCTCTCTTAACGCTATCCATAGCTCGA
GTTTCATTTCGTGCCGACCATCCTGGATTTTGTGGATACACATGTTACCCGGTAATTTACCCTGTAATCTATTCTTTTTTTGCTTATTGCATCATCAAGA
GAAGAGCGCACCGAGATGAACCGCATTTTCGGCAAGAAGAAGGCCGAGGCACCCTCCGTCAACGTCTCCGATGTAGGGGGAAAGGTGGACGCGCGGATCA
CCGACCTCGACATGAAGGTAAGTGGCTGGGACTTGCGCTGCGGCTAATGAGCGCCGCTGACCGAGTAAACCCCAGATAGAGAAACTGGATCAGGAGCTCC
GGAAGCACCGGGAGCAGATGAAAAAGACGCGGGGCCCAGCGCTCAATACTGTGAAACAGCGAGCCATGCAGACACTCAAGCGGAAGAAGATGTTCGAGGC
GCAACGGGACAAACTGACAGCCCAGTCCTTCAATATTGAGCAGGTGCCTTGGACAGATTGACGGGCGTTGATGGGCGTCCGAGGCTGGTACCGAACGCTG
ATCCTGTGCGTGTATGCTCCGCTATCGAACTCTCTGGATTGCAGGCCTCGTTTGCCATTGACACATCAAGGGACACAATCTCAACTGTGGCTGCCATGAA
GAGCGCAGCGGTGCAACTGAAGGCAGAGACACAGAAAATCGACATTTCCGAGCTGGAGGTGAGACTGGCCACATTAACTATGTTGCGTATAGCGAGCTAT
TTGCTGATGCGCCCTGTGCGATTATGCGTGGAGCAGGACGTGCAAGACGACATGGCGGATTTGATGGAGGATATGAACGAGATCCAAGAGATCATGGGGC
GCTCGTACGGGTACGTACTTGCAGCACCTTATCACTGCTTGCCTGAAGTCACAATGCGAGCATATCTGACCGTGTGATGTTCGGGCATTTTTGCCTATCT
GCAGCATCGGCGACGAAATCGACGAAGACGAGTTGGAAGCGGAGCTGGAGGGGCTGGAGGAAGAGTGGGCTGAGGAAGAGGCGCTTGGAGAGGAAGCAGA
GTCGGCGCCGTCGTACCTTGCACCAGCCCAGCACCACGAGCTGCCTGCCGCCCCTCGGGCATCTTAGACTCGGGTACCACAGCTCGCGCTACCGACGAGT
TCGGGCTTCCTGTAGCGTCCTACTCTACGTAGCGCTGCAAGCTGCACACCCAGCAAAACACAAGACCTTACCAATACATTTGCAGCACATTCGCAATACA
GCCATGTGTCATTGCGCAGTTCGTGTCGCTGTCAGCCAAGCGTTGGATCGTGGCCACGCACTTGTCAAACATGGACCGGGAGAGATGGCTACATTATACC
ACGTCAGCGGAGCTACGCTATTGGCCGAGCTTAGACAGCCAATCATTTTTCGGAATCACGTTTGACAGGGTAAAAAATGAATATTACAGGATATGTATTA
TCACAAGGTGGTTATTGATGTATTTGTAAAGCAAGTGTATCTTTCCCTCGCACGAATTCGTTTATATCATTCGCGAGGTTTTTTATCCCCGAGGTTTTAT
CATTCCAAGCAAAATTTGGTTGCGCTCACTTTGGTATTGGTGGTTTTGGCAGCGCTTCGTCGTCAGATTCCAAGCAGCAGTCTGGCAGGTATGGGCCCGC
GAGCAAAGGAGCCGCGCGTGAAGCGCGAACGCAAGGGAAAGAAGGAGTCGCGCAAGAAAGCGGCCGAGGAGAAGAAGGCTGCCGAGAAGGCCGAGGCGCT
CGAGAACATGTCGCACGCCGACCGCTTGGCCGAGGAAGGCATCATCGCCACGTGCTCGCACAACGTGCGCTCGGTTCACAAGAACTTCAAGGACATCAAT
GTGCTCAACTTCAGTATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTTCGGCCGGCGCTACGGCCTCATCGGTCGCAACG
GTTCGGGTAAGTCCACCTTCATGAACGTGCTAGGCGCGCGCGGTATCCCCATTCCGGAGAGCATCGACATCTACCACCTTAAGCACGAAATCGAGGCCAG
TGACATGACGGCGCTCGAGGCCGTGCTCTCCGTGGACGAGGAGCGCAACAAGCTCCAGGCCGAAGCTGACGCTCTCTCGGAGAAGATGACCGACGATTCC
ATCAGCGAGGAAGACAGCGAGGCCATCTCTGACCGTCTGACGGACCTGTACGAGCGTCTCGATGACATGGACGCCGCTACGGCCGAGGTCCGCGCTCGTC
AGATTCTGTCGGGTTTGACGTTCTCGGACGCCATGATGGAGAAGAAGACTAAGGAGTTTTCCGGTGGGTGGCGTATGCGTATCGCGCTCGCCCGTGCTCT
GTTCATTCAGCCGACCCTGCTGCTGCTCGATGAGCCTACCAACCACTTGGATATGGAGGCTGTCGTCTGGCTGGAGGACTACCTGTCCAAGTGGAAGAAG
ATCCTGCTCATGATTTCGCACTCACAGGAGTTTATGAACGAAGTCTGCACGAACATTATCGATCTCACCAACAAGAAGCTCGAGTACTACAATGGTAACT
ACGACACGTACGTGCGCACCAAGGCTGAAAAGGAGGAGAACCAGATGAAGCGTTACAACTGGGAGCAGGAACAGATCAAGCACATGAAGGAGTACATTGC
CAAGTTCGGTCACGGTTCCGCTAAGCTTGCCCGTCAGGCTCAGAGTAAGGAAAAGACGCTGGCCAAGATGGTGCGTGACGGTCTCACGGAGAAGGTCGAG
CAAGAAATGATCGGTGACTTCAAGTTCCCCAACCCGGAACCGCTCCCTCCTCCGGTTCTCATGTTCCAGAATGTGGCTTTCGGTTACCCGGATTGCCCCT
GCTATACTCCGGCGTTGAGATGGGACTTGACCTGGATTCCCGTGTGGCTCTAGTCGGTGCCAATGGTACTGGTAAGACAACCCTGCTCAAGCTTATCACA
GGAGATCTGGTGGCGCGAGAGGGTAACGTCCGACCACACAGCAAACTTCGCATTGCGCGATTCAGCCAGCACTTTGTGGATGTGCTGGACCTGACGAAGA
CCCCGCTTGAATACTTCCGCTCGCTCTTCCAGACGAAGTCTGTTGAGGATGTCCGTAGCTACCTCGGCCGCTACGGCATCACCGGTGAGGTGCAAACACA
GATCATGGGTCAGCTTTCTGACGGACAGAAGAGTCGTGTGGTGTTTGCGTACATGGCGCAGCAGAATGCACACATGCTGCTGCTGGATGAGCCCACGAAT
CACTTGGATATGGAGTCTATTGATGCACTGGCTCGCGCTATTAACAACTTCGAGGGTGGCATGTTGCTGGTGAGTCACGACATGCGATTGATTTCGCAGG
TCGCCAAGGAGATTTGGCTTGTAGAGAACCAGTCTATCAAGGTCTACCAGGGTGAGATTTCCGACTTCAAGATGCGCGTGCGTAAGCAGCTCAAATTGGC
GGACAAGGAACCTGCCAAGGGTGCCGAGTAAATGCTCATGATAGCTTTCTTCTCATTAGATCACCTCTACATGTAGAGCTGTTGAGGCAACCGCTGAAGC
ATTTTCTTAGCACGCTGTTCTGTTCATATTTGATTCCCTTGCCGACAGATAACATAGATTGAAAAATCACACGTTGGTAGTTGATGAAGTT