Description :
From Genome Similarity Track
Location :
contig_87:19871- 21074
Transcript NameFunction/comments
g10497.t1conserved hypothetical protein

Sequence
1203 bases(100 bases per row)
AAGCGAGCTCTGTCAACAGTCACTCCGCCGAAAGAGAGCGTGTGGAGTGCTGCGATCGAGTACTTCCGGGTCTTCCACAACGGCCTCCAAGTATCGGAGT
CATCTGCAGAGGCTTCGATGACAGCTCAGCCTTGCATTCAGCTGGACTTCGTGCGAGCATCCATGGCCCCCGACGTCGTATCCAATTCAGGCTGTGGTGA
AGACGCAGTGATCAGGAGCTGGCAGCGGATCTCATTGTGGTTCCAGGACATCGAGCTGGAGGTGGGGGGCTTGAACAAGGGGCTGCTTCGGGGACTCTAA
CCGCCGCTGCTACACTGAGCGCTACCATCACGGAGCGAACGCTGCGCACCGTTTTCCCTCACGTATGGGGGACTAGAAGTGCCAGTCGTGAGCTTGCCGA
CAAACTTCTTGGGCAACGGGTTGCCATGCGCGGCTCGGTGCGGTTTGAATGGGACACTGCGTTCGGTCGAATAGCGCGTGTGGCGAGTGCGTACGACATG
CTAACGCCGATGCTTGCTCTGCTGGGGAATTTGGAGGACGTCGCACGAGTGTTCGAGGGTCACCCATTTCCCCCGACTTCCAGCTTAGGCTTGCACACTG
AACGTGGTGCGTTGTGTGCACTCTAGCGGGATCTGATGCGACTGAGCGAGCAGTGGGCCAGGCTACGAGTGTCCTGTTCGAGTCGACCCCGCGAGGATTG
TAGACAGTACTCGAGCGTTGCATATCCTTCACCGTGTATTGGGCTGCTATAGCTTCGATACAAGCAACAAGCAGCCAAGGCAGCAGCACCTGAGCGGTGG
TGTTAGTAGAGCAAGAGAAAGGAGTGTATCTGAACGGCGTGCTCTTCGTTGAATCTGATTAAAACTACCACGTCAGGACTTGAGACCTCCACTGAAAGTC
AGGAGTGATGAGAGCCTTGTCAACACGCACGAGACGTCCTCCAAATTGCCCAGAAGGCGCAGCATTGGAGTCAGCATGTCGGCCTGACTGAAGACGCCCT
TCACTCGGCCGTACGCGGCATCCCACTCAAAGCGCGTAACGCCGCGCATGACTATCCTTTGGTTCAGCAGCTTTTCCGCGAGAGCTGCTTCTCCACCCCT
TGACAGGTGTGGGAACACGTTGCGCAGGGTTCGCTCAGTAATGGTGACACTTGTTGTGGTACTTGTGACCAGCGAGTCTGCAGCACCTTTGTGCATGTCT
TCA