Description :
From Genome Similarity Track
Location :
contig_96:19869- 21070
Sequence
1201 bases(100 bases per row)
GCTCCTTCATCATTGAGACTTGATCTTGCTCGTGATCCTCGTATCCGTGCAGTTGCGTCTGCAGCAAGTCGTTCTCAAATAGCAACCCATCGCGATCCCG
TTCCACCCGATCGATCAGCAAGTGCAACTTCTGGTTGTTGTGGCTCAGTTGGGCAATGCGGCGACGTGCAAATGCGACTTGATCTTGCATTTCTCGATTG
CGGACAATCAGTTCCTCACAATATCGACGCCAGGGCTTTTCCGCACCATTTTCGACTTCATGCGATGCATCCCAGGGCTGCTCTACCATACCACAATCAG
CTAGTGTTTCACGTGCAACTGCAGATGCAGTTGGTGCCACGGTCGATGATTCTGCTTGTGTTTCGCCTGACGAGAACGATACTCGAGTTGGCGAGCACCT
CGAGTCGCTATACCTGCATTCTCGAACGAGCTCATCAAAAAGCGACGGGTCCATCACTTTCTCTTCATCGGGGGCCTGAAGCTCGAGCGCACTATTGCTG
TCAAAGCTTTCGTCGTACTCGATGCCATCTTCTTCCTCGCTTGATAAATGGACAGCATATCCTCTACCCAACGCTTCATCGTCCCAGTCAACTTGCTGTG
CGACTCCGTCATGATGACCAGGCGCGTACTGCTCTCTGATATCCACACTGCCAGAAGACAAATCTAGCAGCGGCGACGAGTTAAACGGTGCATACTCGAG
CGGGCGACCAACAACCCACTCACCCCCGTCACTGCTATCCTCATCGCTCTCACAAAACAAATTTTGTTGTTGGGATATGCCATTTTGCTCCATGCCAGGC
CGAAATCGATTGGATAATCCACTTCCATGACGCTCATAGGCTGGAGTAGGCCCCCCGGAAAGGATCCGGACACTGGGGCGCCTGAAAACGAACGGCGAAA
CGATGCCTCATCGACCATTGCAGGTGCACGCCGCTGTTCCTCCGCTGGAGACTTTACCTGATACTGCCGGAACAAATTGCCTCTGATTCTGCCGAAAGGC
CCCCTACCCCAAGTCAACCCATCTACTGCTGCAGCGCAGCTCTTAGCCATGTCTGGTTCGTCAAATTCAAGAAAGGCATGTCCTTTTGTACGTCCAGTGG
AACTTGCCGATGGAATAACCACTTGAATAGGGTCGCCAATCATGCAAAACAAATTGCAAGACAGAACTTCCATCAGCTCTTCCGTGCGGTCCATTGACAC
T