Description :
From Genome Similarity Track
Location :
Scaffold_336:19868- 21807
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_336-snap-gene-0.13Syt7 protein, partial

Sequence
1939 bases(100 bases per row)
AGCCATGACTCTTTGTCGTGAACTTTGTATTGTGCAAAAaGCGTCTTCATTGCTGAAGGAGCCTCGTCTATCTTGTACGTTTCCTTAAAACGGTACTTCT
CATCAGAGAATGGCGTGCGTATGCGCATTAGTCGGCCACCGAATAGTGCACCTTTCGTGAATAATCGCTCATTTGTCGGCCGCGGATTGAGGCGTTGTCC
TTTCCCGTAGTATGCCATGACAGATTCTCCGAGATCACCCGATTTCTTCATTTCGCTACGGACTCTGGCGCGCAAGTCTCGCATCTTTTTTtCATGCACT
TGGTGTGACGATTCAATGTCATGCTTGAAGAACTTGTTCAGGAGGCGCTGGAAACTACCTCCCAGATCGCATGGATCGTAAGATGCGAGATAATCGATGC
ACTTGCGCTGCAATACGGTCGGATTTAGCTGCTTGAGAACCACATACTGGCCAGGCACCATATCGACATTTATTCCGGCCCGAACAAATGACTGCACCCA
GAGCTGAGCGTTAGAGCTCTTGAACTCCATCACGAGGCTACCATCTTTCGTCACTTTTGACAGTTTATCTCGAACTTCTTCACTCATCGGGACATATTTG
ACACCTCCATTCTGTCCGAGCTCTCGTTGAAGAATTGTAGCGTTTGCTACATTGAACCAGCCGTCCTTGACATCATATTGAAAGTTGTATGCGGCCTTGC
ATATAGTGCTGCTCATGTCCACGACAACTGTCGGATTCAACGAGTATTCACTCTCATACACATACATACTTTTGCGCGCTGGGATAAAAaGACAATAATT
CCAGTTCCATAAGATCTCTTCTGCGACCAGCTGTTGAGTCCTTGCTGCAACTGGTTTCAGCAACGAACTCTTTTGTACTTCTTGAGAGAAAAGCAAAGCG
GAGAAGCTATTTTGCAAACCAAGAAATCCTTCGACGTGCTCTTGTAGTTTCTTGCCGTATGTCCGTTTCTGAAtAGCCAGTAGTTCCTCAGCCGAAGGGC
TCTGGGTTGCTAGGCTTACAGTAGGTATTGTTGCGATAGTCTTCTTCTTCGCGTTTGGGGACATTTTCGGGGATACTTCTTCAGGCTGCTCCACAATTTT
CTCGGCATCGATAAAACAATCGATTTCAGGAACGAGATCGAGAGGGAAAAGGCTCGTCTCGCGTTTCTCATTCCTAAGCCACCGGTCAACTTCTCGCAAG
CGATAGAAGCGATCAGCTTTGTCTTCAACAAGGTAATATTTCTTTGCAGCTTCACCTGACGGGGATACACTTTCAATGTACCCTGCGTCTCCCAGTGCAT
TGAGCCACAGCAATACACTGTCCCGAGTGCGCGGGGATTGTAGTGCGTCTGGATCGAGTATTTCATTGTTCCATCCCAGCTTGCTAGTAGCCTTCAAATG
TGGATCGTGGCAGTATTTAACCCAGTGATCTTTCCATAGCACTGCTGGTGCTCGGCATATCCAAGAAATCATTCCCTCCCCGGTGAAGCACCTTGGAAGA
GATAGCACCAATGCACTTGTGCGGTCCTGCATGAAGAAACCGCCAACTCGCTGTAGCTCGCTCTGGCGCACGGCTCTTAAAGCAACCCACTCACCGCGGC
TGATTCCGCTTTCGGGACTCACTCGCTTCCCGTCAGAAGCAGCAATATCCAGTAGCTCCATCTCCAAATCAACTACAATCGATTTTCGTACCTCAACGCC
AATTTCGCTGATCGGGCGTCCAATCCACTCACTGTTTGAATCAGCGTTCACGCTATGGACATGCCGAAAATGAGCCATTTCCTCAGCTGGAAGGTTCTCA
AACGACTCGAACAGCTGGATTTCACGAAGGATGCTGGAGACACGCTTCATGACAATGACGAGAACATTATGGAACGCATCAATTTGAGCATTTTCTGTCG
GTGTAAGAGATGAACGGAGGAGTCGCCGACGTCCGATTC