Description :
From Genome Similarity Track
Location :
Scaffold_75:19863- 20888
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.1Acyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase

Sequence
1025 bases(100 bases per row)
GTTGGATGGCCACGACGCGCCGACGGTGCATCCGACCGCTATCGTCCACCCGAACGCCGAGCTCGGCCGCCATGTTCGCGTCGGCCCGTACTCGATCGTC
GGCCCAGGTACAGCAACCGCTGTAGATTACAATTTGGAGCGGTTGGCGACGGCCTGAAGACAAGTTTTGACAATGGTGGCGGTTGTTTTTTGGTACACTA
TAGATGCAGTACTGGAGAACGGCGTGTGCTTGATGGCCCATGTGGTCGTCGATGGGCTCACGCGTATTGGCAGGGGAACAACGGTGCATCCGTTCGCGTG
TATCGGTGGAGAGCCGCAAGATAAGAAACACCGCATCCACATGGAGCAGCGCCTGTCGTCGTCTTCGCCGTCGTCTTTGGTCATCGGCAGCAACTGCGTG
ATCCGCGAGCACGCCACGATCCACGGCAGTACCTCCTACACCCGAAATAGTCCGACAATGGTCGGTGATGACTGTTGGGTCTTGTGCGGAGCGCACATCG
GACATGACGTCAAGGTCGGCGACCGTGTCGTGATCTCGAACAACGTCTGCATTGCCGGCCACGTCAACATCGGCGACTTTGCAATCATCGGTGGACAGGT
CGGGATCAAGCAGTTTGTGAAAATTGGCAGCCTGGCCATGATCGGCGGACAAAGCGCAGTGGATGGAGACGTTTTACCTTACGGGCTGGTGGTGGGCAAT
CGGGCGAAGCTCGTGGGCATGAATCTCGTCGGCCTTCGTCGCGCACGGATCTCCCGATCCAACATCAAGCTTATGCTACGCGTCTACCGGTACTTGTTCG
ACGCCACTGCGTCCTGCAGCAAGACCGGTTTCGCTCCGCCTCTCGAGTACGTCGATCCACTTGATATCTTTTGTCGGGGAACGAAACGCTGAGTTAGTAA
CTGTGGGTATCTGCAGCTTGCCGTTCCGGAAATCTGTTGTGCTTCGAGCGGAAGAAGTTGCAAAATACCTGGACGAGCGGCAAATCGGCGCGGAAACGAG
TCCGATGGTTCATGAGATGGTGCGT