Description :
From Genome Similarity Track
Location :
Scaffold_52:198584- 200774
Sequence
2190 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ATGGTAGTATTGTCGTGCCACCGACACTCTTAATTCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGC
TACCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTT
TGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGAT
CCACCTGCCCCGACTGCGGCTGTTGCTACCGCCGCTGGCGAGGGGTGTGGGCCATCAAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCA
CGGACTCCATCTCCACGTCTTCGTGCTCCATGTTCGTGGAAGCACTTTGCACTGTGGCACGGGCGCTCCTCATACCCCTGTTCGACCAGGAAACCGACTC
ATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAATAGCCTGTGGCCGTCTGGCCCCACTGGCGAGACCGGATCCGTGAGGCGATTA
CCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGTCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCAGCGTAGGGCCTACTGGATCCCG
AGCCTTCACGTTCACAGGGGCTTCCCGAGCCTTCACGGTGACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAAGGT
CCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACA
CCGGATCCATAGTGCGCGACCTTTCTCCAGTGATGGACTTAACTCTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGT
CGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACTGGTTC
CCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCC
TTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCG
TTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAG
CGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTT
CCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCTGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTG
GCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCA
AAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCAC
CTGGGGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGGTTGGGT
GGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTCAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGG
CCGTAGGGTTGCCTTGCGGGTGTGTTTACTTGCCTTTGTAGCTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG