Description :
From Genome Similarity Track
Location :
contig_10:198504- 199942
Transcript NameFunction/comments
g2773.t1hypothetical protein

Sequence
1438 bases(100 bases per row)
GAGAGGACGTGGAGCTGGCAGTGACCGGAGCAGCCTTCAATCGTCTCAAGAGTATGGGCGAGATGACCAACTGCTCTTCTACGTTCGCATCTTCAGCCGC
ATGACGCCCGACGACAAGGTGGAGTGTGTCAAAATGCACATGGAGGCTGGCGCAGTGACGGGTATGTGTGGAGATGGAGGAAACGACTGTGGGGCGTTGC
GTATTGCTCATGCTGGCATCGCGCTAAGTGATGCGGATGCATCCGTCGTCTCGCCTTTTACCAGCAAACCCAAGACGATTCAGTCGGTGGTTGACATTTG
CCGTGAAGGTCGATGCAGCTTGGCGACGTCGTTTGCGTCGGTCAAGTTCCTCATCATGTACGGCGTCATTGGGTCTACCTTGAGGCTGTTCCAGTGGTAC
AACGCTACTATCCTGTCGGAATGGTTCTTCATCCTGGCCGATGGCTTTACTCTCGTGGGTCTCTCATACGTGATCACCCTGTCGCAGCCCCTACCAGATC
TGCGCGACCAACGTCCTACATCAAGTCTTATCGGGCCATCCACACTGCTCTCAATCCTGGGGCAAGAGGTCATCAACGTCATCTTTTTGCTATCCGGCAT
CTATATGCTCACCTCCCAGCGCTGGTACTGCCCGTTCAGCCCCGACAACGTCGACTTGGCCAAGTGGTGGCTACTATCGGACAACCACTTGGCGACAACG
CTCTTCTTCACGATCATCACACAACAACAGCTCGCCGCGTGGATCTTCAGCTTTGGTTCCCGCTATCGAGCATCGATCTGGCACAACTATCCGCTGTTGG
TGTTGTACGCTGCTCTCGCTGTACTCGACGTGTATCTCCTGCTTGGTCCACCGGGTACACTCACTGACAAGTTTCGCATCTCGAGCGGTACGAACGTGAT
GGTGTTGCCGGACATCCCAATGCCCCTGGCGTTTCGCTCGCAGTACTTGGCGCTGCTGCTGGGCAATGTGACGACAGCAATCTGTTCGAATACTACGTGG
TGCTCGGGCCGGTGAGAGACTGGCTGCGACGCAGGTTTCACAGAGACCATCTCTCTATGCGCACTTGAAAACGTGCCTTGCGTCACATGAGATTTACACC
CACCGCCAAAATTCGGGGGTCAAGAACTGGATCATTAAAACGCACGATGATAGTTGTTTTCTGTATTACTGCATGACAGGCAATTTCGATGATCGTTCGA
AACAATAGGCCTTTAGCTTCGTAATACCTGTACTTCCAGCACCACCTGTCCGTTTCGTACGCTAATGAAGTCGAAAACCTACCACAGTCATTAATCACTC
CCGTTCTGCAAGTATGTAGTGGATACTTCTCCTCAACTCGACAAACCATGAGCGAGGTAAAAACCACAACAGCATAACAAAGAGCGGAGAATCAAGATGG
ACGGACAGGCGCTGATAGCGACTATATAGAAGCAGCTA