Description :
From Genome Similarity Track
Location :
scaffold_29:19850- 20884
Transcript NameFunction/comments
Plaha_PHALS_05096hypothetical protein L914_00904

Sequence
1034 bases(100 bases per row)
CTTGTTGCGAGTATCGTCGCATGACTTTTTGCACGACACTACTCTGCGGTTCGTACAAATGCGTGAACGAAAGTTTTGTCAAGTACAATCGAAAATCTTT
GACATTCGACTCGGGTAAATACACCGCCAGTCGTCGACCGGATGGACCTAGTGTTTTAATGTGTCGTCCACCGTTTAATTCCATACTAAACTTAATCCGA
ATCGCTTCAATCGACAACTCTTCAATGTATACGCCACTGGCGTCCGTGACCGTTGCGCTAGCCGTGCCAACACCACTTCGCTCATCTACGCCTGGTGCGG
GTACGAGTGCTCGACTATTCATTCCAGTAGCATAATCAAATTGTGTGTTGACaatctcttcaaatgaatggTGTGTTGTCAATCCTTCTAACCCTTGAAA
TACGCTGATAAGATTGACGACAAACTTTTCGTCCGTTGAtacttcgagctcttgcaTAATGAGTTCAATTAACTCGTAGTGCGTAAAGTCCCCGGCATGA
CAGCTCGAATTCCAAAGCATTCGAAACTGAATGACGCTTAAGCTATTCGTATCCAGTTCTTCAAAAATACCACGGTACCGATAGTTCACAAAACTCCGCC
AGCGATCCCGTAAGCGCACAGACACACCTTCTTTCACTTGATGTACTTTTGGACCTAATACTACTTCGCACTCCATTTGATTATCCATTTGCAAATTCCC
TAGTGAAAAGACCACTTCACTACTGCCACCAGCACAAGAGTAGAGCAATCCAAGGCGTTGCATGGACAAATAGGCCACTTCGACTAGACTGGAGTTAGCA
TTGTGCAAAAATGATAATCCAATACTTGGAATGATCAAACTCATGTTGTAAATGCCAGTCACTTGCTCATGTTCTCGTACAAATGTGCGAAATTTGAGCG
CCACTAAAACCTCACCGACAACATCGCCGCTCTCTGGGTCTCGCATTTCCCACCAATGACCTTCCACGCGTCCAAGAGATCGACGCGCTTGTTCTGCCGT
GTTGTACGACAGTGCAATTGATCGTTTCGCACCT