Description :
From Genome Similarity Track
Location :
contig_8:198393- 199394
Transcript NameFunction/comments
g1825.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
TCCCCATCGCGTACTTCTTGCAAGCGTGTCTACACGGGTTATTGCAGACGCCCTCCAAGGCTGGATTCATGTATACAGCGTGCCTCACAGTTGCTGAGGC
ACAGCGTCCAAGCCATGCAGCGAGCGAGAGTCCACAAAGTGCTGAGGTGTTTCACACGCTCAAGGCTGCAACTCTGCACAACCTGGCAATTGAGTGGGCC
AATTTAAATATGCCCGACCAAACTCGCGATGCACTAGCGAGCGCTATGGAGGTTGGAGTTCACTACCTTCCCCAAACGCACCCCGTGGTCGTGCGTATAC
TAGAAACCTACAAGGTTATGCGAGAAAATTTCCTGTTCCACAGCAGCAGAAGTGCTACAGCATCAGTTGGGGATCCCCCACAGAGCGCTGCTCGACCAAG
TGCTCCTGTTCGTCCTACCTCGCCACCGCCTCTCGAAAATGGTACCAAGCGACCCTTACCACCCAGAGCACAGAAGGCTTCACACGAATCACCAGGTGAC
CTGACTAGCCCTCGAACCAGACGACTATCGTCTCGTGCAGCATATCATCCGGAATCCGAAGATATTAGCCCTGTGCCTTCGGCTCGGCGACCTACAAGTC
CGACGACAACATCTGTAGTATCGCCACGCGCGCGGGCCGCCAAGAGACCAACCACAACGCCAGCAGTGCCAGCAGGGTTTTCAGGGCAGACCCTGCCGCT
TGGAGCCACGCGCACGTCACATCTTTGGGCAGTACCAGACAGGATTTATGGCCATTCGTTGGGGGCGAAATACAACCCCCACAAAGAGCGCGTTCTTGAA
GAAGCTCGGACATTTGGTATTCGACGACGAGCAGCAATCCGAATACAGGTACGTTAAAGAGAGCAAGGTAGAGGGCCCGGGAGATGCTATCGACAAAGCT
AACGCTTCTCTTGTTATAATAGAAATCATGGCGGAGTGCTCTTCAGCGGCATCGCGCCGTAAAACGAAAGGAAAAGGCCTCCACCCTGATCCAGAGTACT
C