Description :
From Genome Similarity Track
Location :
Scaffold_175:19839- 20878
Sequence
1039 bases(100 bases per row)
CCAAGATCCCACTACCCAACATCGAGGACCTGTTCAGCAAGATGTTTGGATGCGTGGTCCTTACAAAGATCGACCTTGCGTCCGGGTACCATCAAATGCT
TGTGATTCCACATGCACGCAAGTACACGGCATTTCGCACGCACAAGGAGATATTGCAGTGGTGCGTTGCCCCGATGGGAATGGCTGGGATGCCAGGAATT
TGGTCACGCCTTATGCGTTCACTTTTCGACAAGTTCCCATTTGTCATTGTGTACTTGGATGACATTTGCATTTACTCCAAGTCCATGGAGGAACACACTC
AGCATTTGCGCATTGTCTTAGAAGTCCTGCGCAAGGAAAAACTGTATGCGCGGCTTGAGAAGTGTGCGTTTGCTGTGGACAAGGTTGACTTTCTGGGCCA
CACCATCTCTGCTGATGGCCTGCAAGTTGACGCAAGCAAAGTGCGCGCGATTGAGAAGTGGTCTACTCCCACAAATCGCAAGGAGCTGTTGAGTTTCCTG
GGCATGGCAGGGTATTACCGCAAGTTCATCGCCAACTACGCCAAGTTGGTGTTGCCGATAAGTGAGCTTGCGAAGGACAATGTCCCATGGCAGTGGACAG
CGCAGCATGACAAAGCGTTTCTCGTCATCAAGGCGGCGTTGCAACAGGCTCCAGTGTTGCAACTGCCTGACTTTGACAAGCCGTTCATGATCACCACGGA
TGCCTCGGGCTACTGTTGTGGTGCAGTGCTCTCACAGCGGGATGCCGAAGGCGATGATCGCCCAATCGCTTTCCTCTCGAAGAAGTTTGGTGACGCAGAA
CGCAACTGGCCTGCTCATGAAAAGGAGCTGTATGCCATCAAGCTGGCACTGACTAAGTGGAGACCCTACGTCTATGGATCTCACTTCGACGTGTTCACCG
ACAATTCGACTTGTCACTGGTTTCTGAAGACTCCAATCTTAACGCCAAAGTTAACACGTTGGTTGGATTTTTTCAGTAGTTTTGACTTCACGTTGCACCA
TCGTCCAGGCAAGACGAACGTGGTTGCAGATGCATTGTC