Description :
From Genome Similarity Track
Location :
scaffold_532:19838- 23105
Transcript NameFunction/comments
Pl_104051hypothetical protein PHYSODRAFT_286191
Pl_104052hypothetical protein PHYSODRAFT_504740

Sequence
3267 bases(100 bases per row)
GAGTCTTCCTTCGCATATCCAACACCATCTAATCACAAGTACAGTGAATACCCACTACAACCAACTAAACTGAGCAACCAACATACCGCTGTAGGAGACT
GTGCTACCATAGGGAACACCACCGAACTGCACCGAGATCGTCGACAATGTCGCCCACACATTGTCATGCACCAATTGTCTAGCATGTTGCGCCGAGCTCT
CACTCCCTCGCCAATAACTATCACACAAACACATTAGTACACTACAACCAATGCTTCACCTTCTCTAAGCTCACTATTCTTCAGATTCCGCAAGTTGAAA
CGTGTTGGCTCGGAATATCCCAGCTCTACGAGCTTCAACGTCACAGTCCAAGCCGAGGAAGCTCAGCACAACCAGGAAAATGGCAATAATCTGGCAGAAT
TCCTTCATCTTGGACGGATAATAGCGCAATGTCAACTCAGCTTGAGCTTCAGGCGTCACTTTCGGTTCTGCGGATAGCGGAGACCGTCGACCTTGGCGAG
GTGATGGGCTCAAATCCCACTGTTGTCACTATCCGCCAATTACAGTAGCGTATTACGGAATTATCGACCAATCGGAAGGACGCAGAGTCGAACATGCCGG
GTATTGGCTTGAGGCGCGAGGTGTTGGAGCTCTACCGAGAGGTGCTGCGCGTGGCGAGGGCCTTCCCAGATCGAAGCATGGGCCGCAAGCTACAATATAA
TGCGAGGGAGTTGCTGCGTCTGAGACAGCACGAGCACAGCGCCGCGCGCATCCAGACGCATTTAATGGAGGGCCGTGACGCTCTCAGCGTGTACCGAGTG
CTGCAGAATGATCCCAAGCTGCTTACGGCCATCATGAGGAAGAACCAGAGAGTTGCAGACATGAAGCAGAAGTGATGAATAGAACTTGGAGTGGTGCTCA
AGTTGTAAAGGTTACTTCATCACCTGACAGCCATATTGACAATATGGCTACTTTTTCCATCCCATACATGGCATGACAGGGATGTTAATCCCCGAGTGTA
ATCTGCTCCGTTGCATGAACACATGAACTTATACAGTAATAGCTATGGTGAGATGAACTTCATTGTACCGGACTGCAACTTGAACAATATCAAGAAAATC
ATTTAGACTTGCATATTTTGACAGACTGTAACACCTACGATTGTGCCCCTCCCTCCCACCCAGAAAGTCAAGAACCTGAGTGGGGATCTAATGCCCCTCC
CTTTTTGAAGTACTACCTCAACTAGATTATCATTATCAGAACCCCAGAGACCCAGAGCAAAGACTCGCAGGTTTGTTTCGCTCCCTCTCATTGCCAAATT
TGAATCGTGCCTATGACGTGCTAGGTCACAGTGGAAAAGAAATTGGTTGTGATCAGGGATGTTGGATTCGTTGAGCATCCGTGCTGTCGCGAATAAGCGC
TTGATAGGAAGACGATCCGCAAGTGGAAGGAGCTAAAGCTGGGGCTCCAGTTTATCAATAACGGAAGTTGTCGCCTTCTTGATGGAGGACGTTTCGTTGT
TTCCGACGAGAGTTGCTGAGATGACGTAGCACATGCAGGTAAGGACTCTTCCTATTCAACACGACGCACTCGAGAATAATACCTCATGCCTTTAATAGCA
CCCCACCTAAAATAGTACCCCATCCGAGCAGTGGGGCATTAACGCAGTTTCCATGAGGCTACACTTTTGGTCATATCTCGGCTTGTAGAGCGAATTATAT
TAGATATGTTACTCCTCTCGAGTATAACGAGACTTGTAGCGCTGACCTAGATTTGTGAGAACTTCTATATGGTGCTGGATTTCGCACTACGACAAAATTT
CGGGGCAAAGCAATGATTTGGTTTCACTATACCGAAAATGTGGCCATGTTCTTAGTAGTGGGTCTTGTCACCATTCGTGCGGGCTACCTCGAAGCATCGA
GATGGCAAGTGTGACGGGGTCACACAAGCACCTTGCATAGAGGAAGCGTGCTATCACGAGTATACAAACTCCAAGTGAATAGCAGTTCACGAGTCCAGGG
GACTAATTAGCTAGTCGCGTGTTGCCAAGCGTTCAAGCAACACTCAAGCAACACTATAGCTCGATGGTTTTGACCAATGAAAACGACTGACACCTCTTTT
AGCCAAACGTAGTCTTTTAGTATGGGCCAATGAAACGACAGATATTTACACTTGTTTTCAGTATGCCGAGCGAACCCCACCACGTTTCAAACAGTTGGCT
CGGAAAGCTTGGTGGGCTAACTCAGTATACTGAAAACAAGTGAAATTTCGAATGTAAATTCGGAGTTATTTTCTACTCTGATTTACTTTTAAGAAGACGC
TGATTTATGATCCTAGACTTAATAGCTAGAATTAAGACTGACTATAGTTTAGTTCATAGAATAAATATAGTAAAAATAAATATAGTGTGGATCATAGATC
TAGCTGAACTTTGCTAGAATAAAGTAGATTTAAGACTGCATATATATAGTTAATTACCTTAAGTTTGGCCTGTAGTACAATTTCGTAATTAACTATAGTT
TGATCTAAATAAACTTCGCCGATTGGCTCTCAACTGGTGTCAGTGGTGTGTTGTACACCACTGATCCAAAGTATCCCTTAAGTAGATACTTGAAGTTGTC
CACTTCACACGGGCGCACCCAAAACCTGGGTCACCCTTATTAACCCCGTTACATCCTCCCCACTTAGATTGGAACTATCCAACCAATGGGGAGTCGGGAA
GAGATTCCCAATCTCATTCCTTCTCAGTCGATTGCCATCGTCCAGCCACCGTAGTGGTATTGCGGCATTCATTTACCTTTGTGCACACCAGCACCTGGTT
TCCACATCTACCACCTCAAGTATGCCTCGAAAGGCTAGCTCTCGTGGCGCCGTTGTGCCACCCAAGTCTAAGACCTCGCGGTCGAAGGCTGCAAAGGCGG
TCAAGCCGAGAGGCAAGGCTGTCCCTCAACAGGAAGCCCGTTCCGGGTCTTCCGCTGCGGCTAGTTCTTCAGCTGCCGTTGCTGCCGCGAAGGGCGAGAA
CCCGCGACGGAGCCGCTCTCGCTCCCTCTCCCTGACGACCGCCCGAACCCCCGGTTCACATACCGCGACCATAGTCCGGGTTTCGGGAGTTCGAGGTCGA
GTAGCCCTGAGCTTCACATACCTGTGATCACGGGCTTCGACTCGGGAGACAAAGCCGAGGAGTCTGCGAAGACTTCTGCGGCTAGTGTACCGGCGACAGA
CACTAAATGGATTGTGATGATTCCAAGACTAGCCCGAAGTCGGGTAAAGCTGAACCATCGTCTACTG