Description :
From Genome Similarity Track
Location :
Scaffold_14:19837- 21843
Transcript NameFunction/comments
Phyag_g420DEAD/DEAH box RNA helicase, putative

Sequence
2006 bases(100 bases per row)
AAgcccaaggagaagatccCCAAGCCTCGCAAGATCAGCGTCGACATGGTTCCTGAATGGGCGGGCAATGAAGCGGCCAATAAGCCACGCAAAGTGAAAG
GCAGCAAACCTCGTCGCAAACGCAAATTGAGTGAAGGTGcactggaggagcagcggatggaggacgaggctcGACAGCGAGCGTCGCAGCTGCTTGCGCC
GCCTAAGACGAAGGCTGACAAACGCAAGGAGAAgcgagctcgtcgtcgttcgcGTACGGAGTCAATGGGCAGCGAGGCGGCTTCGCAGCAGAGCGAGGGA
GATCCGGTGGACAGTGACagtgaggaagaggaggacgtggaggctgTGAGCTTGTTCAAGTCGAATGGAGAAAGTGATGATGAAGTGATCGTCAATGATA
AGGGTcccaagaaggcgaagaagggTACCAAGAAGGAGGGGAAGAAGGACACTGTCACTGCTGAGCAGGAAGGTGTGCAGTTGCTTCGACGTCAGCTTGG
TATTCGCGTGAGTGGCGTGAGTGTGCCGGCACCAATTACTTCGTTTGCTGATATGCGCTTGGACTCGAGTGCGAGTGCGCAGCAGATGAAACGTCTGTTG
TTGCAGAATATCGAGCGCTCTGAGTACAAGGAGCCTACGTCAGTGCAGATGCAAGCGATCCCGAGTTTTGTGCTTCGACGTGATGTGCTGGCTACAGCGC
CTACAGGTTCCGGTAAGACGGCAGCTTTTGCGATCCCGATCCTAGCAAACCTGGCAGCTGGAAGCGGTACAGGCAGTGGCATTCGCTCAATCGTTTTGGC
CCCTACTCGTGACTTGGCGGTGCAAATTCGTGCTGAGTTCACGCGGCTCGCTGCAGGCAAAAAGTTGCACAtcacgttgctgtcgaaagCCACGGCAGCC
ACCATCGCTTCCCAGACCAAGAGCAAGTTGGCTGTAAACCACGACGTGTTGATTGCGACTCCGCTGCGGCTCGTGCATTTAATCCAAGAAGCGAAGGTCG
ACCTATCAACTGTTGAAATGGTGTGTCTTGATGAGGCCGACAgactgctggagctgggTTTCGTGGAGCAGGTCGATGAGATTTTCGCTGCCTGCACTCA
CGCCAAGGTCCAGCGAGCGATGTTTAGTGCTACAATGCTGGAGGGAGTTGAAGAACTGGCTCAAACTGTGCTGCGGGACCCTGTTAAGATGGCTGTGGGC
ACGAAAAACGCCGGTGCTACCACGATTGACCAAAAATTGGTTTTCGTGGGCAAAGAAGAGGGAAAGCTGGTTGCcatgaagcagctcttgCACGATGGAC
TTCAGTTGCCAGCGTTACTGTTTGTGCAGAACAAGGAGCGTGCCAACGAACTGTACCACGAATTGCTGTATGATGGAGTGAATATCGGTGCCGTTCACGC
TGATCGCACCAAGGAGCAGCGCGACGATGTGATTCGGCGTTTCCGGACGGGAGAAGTTTGGGTGCTCATCTGTACAGACCTCATGAGCCGTGGCATGGAC
TTCAAGGCCGTGAATATGGTTATCAACTACGATTTCCCACAGGTACTTTGGAATGATGTTGTTGGAATATGGTTGACAGCTGCATTGCATCTAACTAATG
TGGTTGTGGAATTTGGTAGAGCGCTGTGAGCTACATTCATCGCATCGGTCGTACGGGACGAAACGGACGCAAGGGCAAGGCTGTCACATTCTTCACAGAA
GATGATATGGTCTACCTTCGCACGATCGCGAACGTGATGAAGCTCTCGGGCTGCGAGGTCCCCGACTGGATGCTCTCGCTGAAGAAGGCCAGGTACGACG
AAGTGATGGCGGGGTGATAATGGTTTGAGTGGTTAACTTAATTGCTTTTCTCGACAGTGTGTCAAAAAGAAAGGAACTGCTGAAGGCACCGCCCACGCGA
CACCGCATTAATACAGTCTCTGGATATGATCTCCAAAAGGCAAACCGTCTaaagcagatgaagcaggcGAAACACAAGAAGGGTGGCGAAGCTGATAATC
AAGCGG