Description :
From Genome Similarity Track
Location :
Scaffold_6:198332- 214723
Transcript NameFunction/comments
Phypa_INRA-310PPTG_03787hypothetical protein

Sequence
16391 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTATAGTAGTATTAGTACCAAAAAAAACCTTTAAATTGACTAGGAGAAAAAAACTGAGATCTGATTCCGTCATCAGTGACAGGTCAGGCACTC
GTAGAAAAAAAAGCAGCTATCAGCCATCGCCTCAATTTGCAGTTGTCGTTCTCAGCCGAGAAAAGCCAAATTTTGTGTAACTTGAGCATACCCCCCCCCC
CCCCGACTCAACAGACGCCTGTACTTTTGGCATACGCTTGTTGAATGCAGACGACAACGGTGATAAGTTTCGCCCCCGGAACGTCGTCATCATGACGTTG
TTTTTGGGATACGCCGAGTCTCCGAAGACAAGATACTGGTTCTGCCGAATGTCAGCGTTGCTATCTAAAAACGGCAAGACATTGAAGTGCGAAGGATATA
CCCGTCGCCTCGACGTCTGTCCTTGCATCGGTATCAGTGTGCTATTAAGTGAGCGAAGTGCTTAGTGAAAATTTTGGATTAAGGTGAATCAGAACAGTTG
ATATCTAAGTACGCTCGATGGACCACTGATCACTAGAGATGTGAAGGTTCAGGTGCTGAACCTTTGTGAACCTCCCGTTACGTCTGCATCCGGAGGTACC
ACTGAAAGGTATCTGAATCCCTCCAAACCTACTTCAACCACCTTCTACCCCCTCATTGATACATCAGCGTTAATTTAAGCTCAAGTGTTTTGATCATACT
GAGGATCATTTTCCATTATGGAAGCACAGCAGCACTCGCGCGGCCACCACACACCACGTCTGCACCGTCCGCCAGCACCTTGACGCGTGCTTTTCGACGA
TGACGAAGTGCATCCTGCACTGCCAGCTTCAGTCCCGGCTCAACCATCGAGGTCGTTTCCTCGACGATCGCACCAGTCGTAACAACAGCTCTCGCTGCAA
TCGCAGCCACAGTAGCTCTGGTAAGCACACGAACCACAGAGGCAGGAGCAGCTCACCCAGCCGCCACAGCAATTCTGGCAACACCAGCAGTCACAGGCGC
CGCTCTGGCAACATCAACTACAGGAACAACTCTGGCAATACCAGTCGCCGCAGCAACCCCAGCGCCCATGCATCCGCCCTCCGGTTCTCGAAAACTAGAG
TACTGTCATTGACGTTCAGGCACTGCAACAGCGTGCTGAACGTGAATCAGGGTTAGTGCTGTTTATTATGAAGCGTCAGAAGAGGAGAGATGCTTGGCAT
TTCGCTCGGCTCATCCGAAGCGAGGCGTACAGACACATTGAGCGTAATGATCTGAACAACGATCATGCCGAGCTCGCGTATTGTCTACTTTGCAGTGCAA
AAGTTAAGTTTGTGTTGGTCAGTCGAAGTTGCCGCTGCATATGGAAATGTACCATTCGGAAGAGCTGGAGGCGTACAACACCAAAGCGGAGCAACGAAAT
CAGAGGGCAGCCCAAGTTCCATTTCACACCTTTTCTAATGGAAAAAGGCAGAAGCTGCGTACCATATCAGCGGAGCAACAGAAGAGCGTGAATCTTCTTC
TTGCTGAGTGGATCGCACGGCACTTTCGGCAGATGATGATTGTGGAACATGGTGGATTTGTCGTATTTATTCGGTACATTACCGAAGATATTTGTGGAAT
CAAAATGAGGCCTCCTGAGCGAACTAAGATTGCGCAACATACGGTGGCTTTAGCTGGGGAGTATCGAAAACGAGTACGGCAGGCCATTGTGAAGGGTTGT
TGGTATTTCTCAATGACGTGTGATATATGGGCTTCCCGAAACACGAAAAGCTACAATTCGCTGACAATTCATTACGTGGACGATGAATTTTTCCCTCAGA
ATTGGACTTTGGAAGTTAAAGAGCTGGCCGGTATCCCTGATGGAAATGCCATTGCTGACGCGATTGAACAAATTCTGGAGGAGTGGGAGTTGTCTAAGCT
CTACTGTGTTCGGTTTTTGAGAGATGGGGGCACAAACATGGTTGCTGCTGGTGAACTATTACATGTCGAGCATATGGCATGCCTAGCACATTTCCTGCAT
CTAGTCGTTGGTGGAGCAATGATTAACCCTTTCGCGAACGGGTACTTTTGACCTGGCTATATTATAGCATAGAAGGTTAAGTTATTAGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGTCGAGCGGCGACCTGACGGGGCACAATGTACGCGAAGGAGTTGGAATCGTCGAACGGCAAGGTCATCAGCGACAAGGTT
ACGGTGGACAAGTCGGTGGTGGCTAACCTCGCGGAGACGCTCGTACATGTAAGTCCCGGAAGCCTGTTGAGAAATTTTGTTTAGTGTGTTGAACACAAAA
TAGATGTCATAGTATTTTCAAGTATAAACTACCACGGAGGTTCACGGAGGTTCCGAGGTGCTTCAGCTGAACTGTACCGCCCGCGAACGCACAGGCCGCA
AATAGAGGTTCAGCTGAACGTTCACACCACTACTGATCACGGTAAACCAATCAACGAGGACGGGTTACCAATCAACGATCAACGATCAAGGCTGAACGGC
AGCGACCGACGATCAAGGCTGAAGAACCGGTAGCTGAAGATGACCGACAGTGGAACAAGGCTGTCGGCCACGACACCAGCCACGATCCACGTTCAAGATG
CGCTAATTCTGAACGGACGGCCAACGACCACCTCTCTCCGATGGAGCGATCAAGATGTAGCTATAGACGATCAAGGGAGCCCAGTCGCGATCAACGACCA
AGATGGCGGTCGGCGATCAACCTGACGATGAACGACTAAGATGGCGATAGGCGATCGAGACGGTTGATCGGTCGATCGGCGGGAAGATCGGAAGAGCCAA
CATGGGGATGGGTCTGAATATAGGTATGCGTAAGATTTAGGTTGGGATAGGAGGTAGGTAGACACATGGTCAACATCAATCAGAAGCCGTTTTGCTTAGA
AGCGCACAAGTCTTCATCGTTCGCCAGGAAAGAGAAGAATTTTTTGGCCCCCTCGAGTTCGAACAAGGCTTAAGTAGTGGGGACTAGCGTCATAGAGTAA
GATCTGGACAATGTATTGACAAGATCTGCTACACTAGTGTTATTTGTTTATTGCATTGTGTTCAAGTGTACCCCCCGTTAGTCGGCGTCTTGGCGAAGTG
TGTGGACGGCGATCGGCCTCAACCAGTTGTTGGCTGATTCCCGACACCACATTAGCCTGCCAAGTCCAGTAAATGCTTCCAATTTTTTTTGAAAATAATA
GCAAGGCAGAATCTCCTTACCGGCCGGCCCCTCGAGTGTTTGATATTTGAAGCAGTGCTTGTTTTTATGTCCGCTAAACTGAGCTTGCTGACCACGCGTT
GGTCAACAGTAGCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTGGGGGGGGGGGGGTCCAGGGCGAATTAGTGCTTACGTGACGGCGATTTCCCCTCGAACCTGGAAAATGTCACTAAA
TTTTTCCAGATTCGAGGTTCCAAGCCTTATGTGAAGAGGGCAGAAGTTGTAGAGAAAGACACGTAGGAGCAGCTAGCTTTAGCCAACTAAATCCAAACTC
ACTTAGTCTGTAATCTCACTTACAAGCCCTCTCTCATCTACCGCCTTCAATGTTCTTTCTTACCTTCCTTTTTTAATCTACCAAATTGCCTATAAGCCTT
CCTGGACATTCATAAACGTACAACTGCTCTGCTTTTAAGCGTGCCGTGTGCATCAATACCAACTTCGTAGTGGTGCACACTGCACGTTTATTGCCACAGT
TTTAGATGGCAAATGCTACTGATACTGCGCAGTGCTTTTGCAGTCTCGCGTTCCGGTCTCAGGCCCAAAGATCGCGGATAACAGAGTCAGTGATATCCAT
AAGCTCGACGAGATTAGTGAGGATTTCCCTCAAGGCCGCATGGCGAAGCGTGACGAGATGACCCGAATATTGGGGAGCTGAGTCACCGGCGTTGTAATAC
GAGGAGACTCGTATGACCGTCACCGACGTGGCAGGCGCGACTCCCACAGCTGTCGTGGCAGCTATTGCACAGTCACGAGTGGCATTCGTTGAAGTTGAAG
TCTCGCTGGATGGCATAATAGTTGATTAGGAAGATCGCGAAACTACTCGAGGTGGGGCGGTCGGACGGTGACATCATGCGCACATCGACGACTCAGATGG
TTATGAAAATTACCAGTCGGAGATTTTCGCGACAGACGCGAGTAAAACCGCGACTTCACCCGCGAAAACCAGTGCAACCAGTACGGACTGTGCGCGTGCG
GTGGCTGGTTGAGTCACTCAGTTAGGAGAAGGCAATGATTGTGCTTTTTTTCTTGCCAGCGAATATCATGCGAAACTGTCGCGATGCTTTCGTGTCGCCG
TTATCGGTCACACGACAGGCCTGGGACGGGTTGACATAACCGAATTGGTACTCAACCAAGCACTTGTCTTTGGGCTGGCAAAGTACCATTTAGTCGCTGA
GATCGTAAACGAGCTGGGGGAGACGCTAATATCTGTGATGGAGAAGTGTTTCGAGAGTTAATAAGGAGGGGAACCGTTGTGCTATCCAGCATATCAAGAA
ATAAAAATGCCAGAGTTCTGACGAGGATCATCGATCTCTATCTGCCGTGTAGCGAGCATAAATACAGCATTTGCCGAATAGCTAGATACCTAAATAATGA
AATGGGTGTTGCGAAAATCATCATTTGAGTAGCGATAAACAACAATAATGACTACGAAAGATACGGTAGTACCGTTCAAAGGTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGAAGGAAGGCTGGAGATCTGCGCAGTAGCGTTAAAAAATTGAAGACTGATCTCCAAGC
CTGGCTGTCGGTCTGCGAGTGTGGCTGTGAGCCAGTAAATTTGAGTGTCGCGTGCCTGCTGACAAGTGTCGCCATATTATTGGTAGATAACGAGCCAATA
GAATAATCCCAGCCATGACTGGCTGCCCTCAACTCACACTATCCGGACGCATCTTTTTTTTTATCTGGACGATAAAAAAATCCCAGGCTCATTTCTGAAT
TTATCGGCTCTAAAGCACAGTGTTCCTGAGCCAAAGTTGCATCAAAATACATAGAAACAGAAAATCGCGATTTTCTCAGCTCACAGAGCGTTTCAGGCGA
TTTCCTGCCGCCTATAAACTCAACACAAAACTTGCTCTCTGGCATTCCTATCACTGTTTTAGTTCCCCTAATCTCAAACACATCATTTACACAAATTTCA
TGTGTTCTACATTTATGTGCCAGCTTTCTGGTACAGGTCGGAGGGTCGGAGGTCGGAGATTTTATGGTATGGTAGAGGACCGAGGACACCTCTACCAGCG
AGAATGAGTATATTTGATTGGTCTAAAAGCTGAATCAAGCGCTTTGAAGTGTAGCCATGACCTTGGTAGAGGTCTGTGGTAACCCCTATCAAAGCATCTC
CCAGCCCTAGTTACATCGATATAAGTCAGTTAAAGCCCCCCCTCCCTCCTCCTCACATTTGCAACAGATCGGTGTGCAGCATGGAGGACAACACCGAAGA
CGTGACAGCAGACTGGGATGTTGACTTCAAAAGACGAGCTAGGCACAAGCATGACGGACGCCAGCGGCGACGTTGCTACATCCGAAGGAGGAGAAGGTAG
ATGTGAGCGTGCACAAGTGCTTGTGTCAGAAGCAGAAACTCCCGGTACTCGACGCATGCCTGACAACATCACAGAGCAATATATTGCTTCACTAAAGACC
AAAGCAGTCTTTACGTCGCGATAGCAGACCAAGTGGCTAAAGCATACGACAATAGCGCGGAGTATGGCTCTCTTCTTCACGGCGGCACCCGAGGAGAGGC
TCCGAAAGTGGACATCAGATGTCCTTATTGGTACTGGACATGCAGCTATAACCAATATGGAATTCAATGCCTAGTTAGGACTTGAAATTGCAACTACCAT
TTGCCCTATGAATGACATCGCTGACTACTGGTCTACTAGTCGCTTTCTCGGGCAGAGTGCTTTTATTGACACCATGACAAGAACAAGATTCCAACAAATT
CGTAGATCATTGACACTTCACCCCTCGCAAGACTCATCTTTTGACAAGGAGGAAGATCCACTGTGGCGCTGCCGAGGTGTTATGGAGCATTTCCAAAAGA
GATTCGCTGAGTTCGCAGTTCCCGTTGGTGCGAGCAGCTTTGATGAGATGACTGTATCAACTAAAGCAAGGACCCGGGCGAAAACTCTTATTCCATCCAA
GCCAGACAAGTATGGCGTTCGGTTTTACACCCTCGTGGGGTGGGGTTCACTGTATGTGCACTCACTTTGGGATAACTCATCGGGCAATAGG