Description :
From Genome Similarity Track
Location :
Scaffold_113:198324- 202617
Sequence
4293 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCAGTGGATCTAGAACTTTCGTGGGACAGTGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCA
GATCCACGACGAGTGTGCACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCAAAATAGGGTGACCAGGATGATTACGTCATGGA
TCCGGTGGATATGAAGATAACACAGCTGGGGTGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGA
AGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCAATTTGCACAGTAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACA
TTGGCCGTACGAGCTACGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTT
TCCTTTACTCGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGC
AAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAAT
ATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACC
ACTTGAACTCTTCGTAAGTTACCGAGAGAGCAGATCCCACCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACAGATCATCGGGGGACCC
CCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCGACATCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGA
TTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAACGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGCACTGTTCT
CTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGA
TGCCGTTTGGATTGAAGAACGCACCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCC
GGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTC
TGATCCCGGCGGAATCGTGGGATCCGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTTTTAGTGTGGTAAAGAGATA
TTGGGGGATGCGCAAGGTGGAGTACTTGGGCCATCGAGTTTCCAGGGAGGGATTGGAGGCAAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTC
CCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACGAAT
TGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGACGTCGGATCCACGAAGGGATCCAAG
TAATACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATG
GAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCTTTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAAC
GTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACCTTCGTCAGCCG
GACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGA
CCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTAGAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTT
GGACGCTGGAGATTGTGCAGTGTTCGAAAGAAGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGAC
TAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCAGAGTTTCGATGGATCC
GCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGCCAGATCCACATACGCAGAAGGCCTCA
CCGCCAATGAAGCGGAGTATAACGGACTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATCCGAAATAACTGGTGATTTGTGGGAATTCAAATTTGGT
GATCAGACAGGTGCGAGGTGAGATTGATTGCAAGGCCCCGACCCTAACGCTGTTTCGGCAGAAGGTGATGGTCCACCTGCGTAGTTGGATGAATGACGAG
TTGGTGCATGTCAAGCGAGATTGGAATCCCAGTGCAGATAGTTTGGCCAGAGCCGCTTTACGGAATCAATGTGGTGTCGAGGTGGAGAGAGAGGACGAGC
TTCAGGATCTCGTCACGTTAAACCGACTAGACGAAGTGGTGGTGGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAG
GATTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGCGAAGGGAGTCCGTATTGAGCGGATCCTCAAAGCACAAAACGAGGAAGCGTGGATCTTGGGA
CTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACTAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACT
TGCTCTTCTATTGCCCCCGTACGAAGAGAGTCAACGAGGATTGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTGCAACAGGATGTCC