Description :
From Genome Similarity Track
Location :
Scaffold_33:198301- 200853
Transcript NameFunction/comments
Phyci_92422conserved hypothetical protein
Phyci_79981conserved hypothetical protein

Sequence
2552 bases(100 bases per row)
GGTCCTCCTCAGCGTCTCCGTCGCCCAgcgccgcccccgcggcgccgcgcTGCCGGTCGGAAGGCCGCATCTTCGATCTGATGCCAAAGTGTGATTTAAC
AGGATTTTGTCCAATGACAAGTGGGTTGCGATCTTTCGACCATCGAATTTAGTGTAAAGACACATCAAGTTGAAGTTGCCTTCAACTTCAGATGTATGTA
CATGCACTACAGGAAGCTGCCCCACTGCTGGTCGGGGGCAACAGTGGCCTCGGGCGCGCGGACCTGCTCAAGCTGTTGCGCGCGCGCGAACGAGGACAGG
CGGTCGGTGGGGATGCTCACGTCCTTGTGGAAACTCGTCGTCGACCTCACGTCCGGCGCGAAGCTCGCAGGCGTGGGCTCTGTCACGGCAAATGTAGCTC
CAACAACGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCGTACGTGGAAGTGCATCGGCAGCTCAAGGAGCAACTCGGTGACAGCGGCGATCTTGGCGTTCATATAGTGAAGTGCGTGTTG
ACATACACTCAGCTTGCCACCGTGCCCCTCCTGCAATTTGACTCGCCACAATAGGCTTGAGTTGACACTGACCAGCAGCACGGGTGAACAAACGTCAAGA
TTGCAACATCATCCTAGATCCCTGCGGGTTAGAGGCGTACCTTTGCCAACAGTGCTGGAAGAACGCTGCAGTAGCGAATTGAGACTGTGGTAGTCGAAGA
AGTGTATCAAAGTGAAGCACGTAGCGATTACTGAATGCCAGGCGGATCGGAGTGGCGGAGGCTTCCTCTGCAGGATTGGCACCACCGATATCGTCGCCAT
CTTGACTGGGTTCCTGGACGAGTACTGTTTGTACCAGAAAGGTGGCTTGAGTGAACTTGCACACACGGAACCGCTTTTCCGCCTTGATAACCCCAAACGG
AGGTAAGCTGGTACTGCCTCCGCTAGTACCGACGCTAACGGTCTCTCCAGCACGCAGTAGACGGAGTTTTAGATCATTTGAAGCGTCGACGCACTGAACA
ACACCCACTCCTCCAAGAGGACGAAGCTGGATTTCCAGGTCGTTGAGGGGCCACGTCGTGAGATTGCAGCAGCTAACTTCGAGTGAAATCGTCTCTTCTT
TTTCAATGAAGGGGTGGTGGTGGGAGATCCGAATGGAAACCGGGTCGGCACTTCCAGTGACGATTACGGCCTCTCGATATTCCTCGCCTTGCGAAGCTTT
TGGGTGATTGTTTTCATCTAGATGCTTTCTTGGCAGAAAAATATCTTGCGGATCGAATATCTCTTTAGAGTGCGGAGTGTCTGGACCCAACAGCGAGTCC
GCTGTTGATGCCGTTGATAGAACAACCATAACATCCTCGATTCTGGTGAAAATTAAACAAACAAAATCATTAGTCATGCGAATTAAGGGGGGAGAGAGAG
AGATTGCGCCAACGCACACACGATACTGCTGCGACGTGGTTGCTGGAGGACTTCCTGATGCTGACAATGCTGCAATCATCTTCTCGCACATTTGAAGGAA
TTGGGGCTGCATTTGGGGCTGATACTGCGAGAGGATCGTAATACAGTCACCGAGAACCATCAACGCATCCACGTTGTTAGCATCTCCTGCGCGTTTACGA
CTCGCAGGTGTCTCCTCTCCAGCACCACCACACCCAAGCAATCCGGTGTCGAATGTCGCACCCTCCATTTCATCGTCGTCATTCCAGATTGCGGTGAAGA
GCCTACCAGTCTCATGTTGTAGCTCTCGCACCAATGTTTCAAACGATACGTGTGACGCATAGTTGCGGTGAAGACGCACACCAACCCAAAGTATCTGCAG
GCGAGCACTTTGGGACGCAATCTGGTCCATAGTTGGGAACAACTCTTGCTGGAAAAAATCGAGAGACTCAAGAAGCGCGAGTTCCGGGAACGCAAGCATC
CCCTGAAAGTGTGATGTTAACAAGCCAGTATAGTATACGATGTTCTCGCTGATCTCACACGACCGACGATACGCCTTTGGTGAAGTGGTAGCAGAACCTC
CCAACTTTAGTAGCAGCAGCCCACGAAACACTCTCAAAGCAATAAGCTGCGATATTTGGTGCTCAATAGCTCCACGTCGAGGGGGTGACGTCAATTCGGA
CGTGGTAGCAAGGGCATGAAATAGCGCTCGAAACACTTCGGAGCCATTGGTGCGTGGTGATAACCTGGAGAATCCTTTTGGCTGTCGGAAAAATGTCATC
GTGCACAATCCCTGAAGCAATTGAAAGTCTCGGTTGGCAACAACATGCGCAG