Description :
From Genome Similarity Track
Location :
Scaffold_1053:1983- 3346
Sequence
1363 bases(100 bases per row)
CCGAGGCATCCCGACGTGCATTGATAGTGTATGTGCTACTTGTGCGAGGTGGCTCTCTATTGATCAATATCTCACAAGGAGCTCTTATCTGATTTGTACA
GCTCCACATCCTTTCGCACCACCTGAAGATTGCGTCTCGTGTTGAGATCTTCACGTCCAGCAGCGCCCCACGAAAGCACGAGCGGAACGGAGAAGGAGAG
GCGATAATGGGAACAGTGGACTTCCAGCGTCTGGGCTTTGTCTCGTTCCAGAGCAGCGAGATCACCGACTTCTCATCCCAAGAGCTCAAGATCGTGCATT
TGCAAGCCCACGAGAAGATCACGCTCATTCGCCTCGTCCTGCATCGGTGCCACGCGAACCGAGATAACCTGTTCCAGCAAGTGGGGCTACTCTCGGTTGT
CGCGTTCTCCTCCCAGAAGAAGAAGAAGAGTGTGCACAGCAGTGCGTCGTGGTCGCCAGAGAAAAGCGTCTTCCTGCCTTCTTTGCACCCCAGAGCAGCA
GCTACTGAAAAGCAACAGTCGCTTGGGGTCAGTGGGGAAAGCACAGATCACCTGTTTTCGTTCTCGTTGTCTCCACTTCGAGCGAAATACGCGACCAGCT
TGATGGCTCCAGACCGGAACTCGCAAGCCAAGAAAGCCGCATCAACACCAACATCACTACTGCAGTCAAATCATGGGACTCCTATGGGGTCAAGTAGTGC
AACTACGGAGTACGAAGTGTGGATCCCCGACCTCCACAAGTTTCGAACGCCACTCCAGATCGCCACGCGCGTCAGACTCTCGAGAGAGCTCGCACTGAGT
GAGTCCGGGAATGGCTCCCGAGCAGCACAGTTCTGGCGATCGATGGACCTCGAATGCCGCCACTTGCTCAACAAACTCGACATTCTGCAGCGCACGTACG
ACGACACGAACCATTTAATTGCCGTCGACGACCGGATCGCGATGCACGAGGAGATCGATCACGTTGTCCGCGATTTTGGTGCAATTAGCTCGAAAGCGCT
TGCGAGTGAGCTGGAGATACTAGAGCAAGAGCGTGAGAGTCCTCCATATACACTCACGAGCGAGCCTGAAAACTCGTTGCTCCAGGCCTTTCTCGACTTG
AAGAGAGAGCTAGAGACCGAGGGCTGGCAAACACGAGAGGAGCTGGTGTGGAAAGTGGTTGAGCACCTCCGAAAGGTGAGCGCAGACGATAGAGCGAAGC
CCCGGTCGTCATTATCATCTACTACAGAGGACGAAGCCTTGGCAATAGTTAAGCAAGTGCTGCGCGACGACACCCACAGCCAAGTGTTCATCGCTGGGTG
CTCCCTACTTCAGCAGGTCTTGGCAAGTGTGAACATTCTCCAAGATCCTGCATCAATGAAGAA