Description :
From Genome Similarity Track
Location :
Scaffold_43:19827- 22842
Sequence
3015 bases(100 bases per row)
CGCTTCCTCGTTGCACAAGCGTGTGTGCCGTGTATTGGGAACTGTTGTGAACAGCGTCCCATTACACCTGGTAGTACTTCGAGCGGTCCTTCCAACGACC
CAGTGAAGTGAAAGGTTTGACGACGCGGCTTTAAGCACGTCGCGCATTCCTGTTCAAGACCTACTCTTACCCATGTCCGGGAACATGGAAGGAGTTGATG
TGCCACTCGGTTCAGCAGTACCGCAAACTGTCGAGTTGACGAATGAGTATTTTCCTCATTTGTCTTCTCATGAGTGGTCAGCGCTGGAGCGGATGAGAGA
TGTCATCGGGGAGGCTGCTGTGGTCAGCCTGCTTCGATCGGCATCTCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAA
TCTCGAAAGCAGGTCGCAACCCCTGTTTCGTCCTTCAAGACGGTGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCGGAGAGAACGAGCCTCTTTCGA
GATGGTTCGTTGAGTTGGATGCAGCAGTGTCTGCAAGACAACTCCGCGACCCCTCGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAA
GAGCTGGGCTTATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGT
GAGTTCCGTGCACGCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGCCTCGAGCATTGTGG
ACGAGCCGATTGACGTCCCAACGCAAGTTGTGACGTTCATGACGGGTCTGAACGACGGTCCAATCCGGAAGCAATTGTTCCGTGAGTACCCAAAGACCCT
TGAAGAAGCCATCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCGTT
CATGATGGTCCAGAGCCAATGGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGAAAGTCGGGCC
ACTTCGCTCGAAATTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCG
TTCCCAAAGGTAAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGGAACACAGGACTCTGGCC
CCAATGTGCATGATGCACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAAC
GCCTCTACGTGCTTTAGTTGACACTGGTGCGTCGGACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACATCTCTGTGCCTGTTGCGAATGAAGAG
AAGATGATGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACG
AGTTCATTTTACTCGACCTCGGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGA
TCTCCGTTGACAAGCCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGAAGAAGTCCCAGATGGCCCTTG
TGATATTGCGGTGTGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTC
TCCTTTGCCATCGACGACAAAGTTGCGTGCGATGGTAGTGTGAAGAACGACGAGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCA
AGAAGAGTGTTCCGCCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCACAAGACATTTCAAGCGAGTTTGT
GAACGTTCTGGTCTCGAACGAAGATGGTGACGTCGATGTAATCCGTCACATGAAGATTGAAAATCCTCCAAGTCTGGCTCAAGAATTGATTTCCTTGCCA
TGGATGAGCAAGAAGACGCTGAAGCGTAGCCTGGTGAAAGGCGAAATTTCGCAAATTTGTGTGATCGTCGATGAAGCTGCCGGCGATGCTATCAACACTG
CGGAAGTGTTAGATGAAAGGACACGGAAGGAAAGGTTTGATGAGCAGTCGTGGGACGCTCTAAAGATAAACCCCGTGTATGGACTTGTCAAGGAATATGC
TGACATATTTCCAGACAAGGTGCCGGACGAATTGCCGTCGGACAGAGGTATTCGTCATGAGATTGATGTACTTCCTGGCACGAAGTACTGTATCACACGA
CAGTGGCCGTTGCCAAGAGAACAAGTCATTGCGATCGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAAGTCTCCGCATTGTA
ATCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGACGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACGATTCCAGCCCAAACTCCGGTTCC
ACGCAAGGATATGATCCTTGATGGAATGGTTGGCAGTACAGTCTTCAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGTATGCGCGAAGATGAT
GTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAGTGGATGGTGATGCCACAAGGTCTGAAGAACGCACCAGCAACTTTCAACAGAATGG
TCACGAATGTACTTCGTCCATTAAGAGAGTTTGCACCGAGCTACTTTGACGACATATTCGTTCACAGCAAGGCCTCGGAAGGGAAGAAAGATGTCGATGT
TCATCTTGGACATCT