Description :
From Genome Similarity Track
Location :
scaffold_528:19826- 22639
Transcript NameFunction/comments
g9019.t1 hypothetical protein PHYSODRAFT_326164
g9020.t1 hypothetical protein PHYSODRAFT_555053

Sequence
2813 bases(100 bases per row)
GCCTGCAAACGTCTTCGCGGACACAATCTCCTCCACACGCGCAATGTACGTGGGCTCTATGGGGTCAGAGCTAGACACAGACGTGGTCGCGGTCAACGAG
GCACTGGTGGTGGGCAATATGATCAGAGCTTTAAACAGCATGGATGAGCACAAGATGACCGTGGCGTTCTTCGAAGCCTACGACGTCGACCGAAAGACGT
GGCTGCAAGAGCACCAGCTACAAGAGGCAGCCAAGGTGCCGGATGACGACGTGAGTGTTGAAGAGGTGATGTCGCAGCTGGAAGAAAAGAAGACAGTGAT
CGAGAACGTCACGCAGTTGCCAATTGCCGTGTACGCGTGCTATCTTCGCTCGTTGTTTGCTCAGAACCATACGACAAAGATCGTGCGCCTCTTCCGAGAC
GATGAACCCCAGCTAGAAAGGGTCTGCAGTGTGATTCCCAATCTCTACTTGCTTCTCCAAGCATGCTACAAAGAGATGGATGGAAACCTGGCGCGTCGAG
CAATTGAGAGAATCACTGAACACTCCCCTACTGCCGTCATTCCGCAAGGTTGCTACGACCTCGCCATCCGATCCATCCTTCGCGATCGCCAGCGCGATGA
ACACGACTTGCTCGATGCGGTTTACCTCGCAAAAACTATGAACGAGGATGCAGGGTACATTTTAAAGCCCTGGATTTGGAGCGCTCTGGTCAAGGTAAGC
TTGATTATGAACCGCCCAGACCTCGCACTCCAGATTTTCAAGGGGTACCCACGCAACTGTATACCTGAGTACCAGAAGAGTTTTCGTCAAGCGTTGCGTG
CAGCCTGCAAGCACACAGACTCCACTGCGCTTGATATGATGCATTTCTGCTGGGCCAGGTACAACGATGAATACTCGAATGCCAAAACGTTGGTTGATGA
ACGACGAGCGTACCAAGATGCTATTTACCTTACGAAATCAGGCACCGAAGGGCTATCGCTGGGGGATGCAGTTCTGGTCTCGAGTGCTCCTGCGTTGAAC
AAGGACGCTGAAGCCGAGTTGCTCAATATGATGCTGTGGGAAATGCTCAAGCATCGCCACGCAGTGCCATCTCTTGTGCAAGTGCTGGATCTCATGGAAT
CTGCTGGCTCAAAAGGTGGTGCAATGGCCTTACGGAAAGCAGTGTTCGCTCTGTTTCAGTACGATGTGAAGCAGAAGAAGGTGTCGCCTCAGGAAGCGGT
AGAGAACTCGGTGAAATTTTGGGGGGAGCACTCGTCAGTGCTGAATGGCCAAGGCTTCCTAGTGCACTTGCTACTGGAGGAGTGTGTGAAGCACCACTGG
GACGACGCGTGCGATGTCTTGGTGGACTACTTGCTGGATGTTGGCGTATCTCGCCTGCCAGTTAACTCGATCGTCAATATGATGGGAACGAATGAGGTAC
GAGGGCGGTTCGAAGCCAATGCGAGCCTTGGTGAAAAGCTTCTTCAAAAGCTTTCTCGAAGCAACGTTGCGAAGCTTCGTGAAGATTTCTATGAGCGCTA
CCTGATGAGCTACCTCCGTCTCGAGCGATTCGACGAAGTTGGGCAACAGTACGCCAAGCTCAATCTGAAGAAGCGCTATCCGCACAGCAAAGTGATCCGT
ACAGTTGTCCAAGATTCAGCAGCGCAATTATCGGACAACGATGTCAAGCCTGATGTTGATGCTACCCCATAAAGATCAATGTTAAACTGGAGGGCCTGAA
TGAACAGCAGCAGTTTTGACTGAACAACAGTGGATTCACGCTAGTTACCGCTTTTCCTGTGGGGTTATTCTTGATAAATAGTGTCCCGCTTCTCGCTACA
GAGTGCAGTTCTAATGAGTCCGCTACAGCTTACCATTTCTCGGTGTGAGCCTGTTCAAGTGCGATGCAGATCAGCACCATGAGCGCCATGTCAACGCCGC
CCATGATGGCCAGGAAGTACTCGTCGTCCGGCTGACTACTGGACAAGGACGAGCTGCGTGCAGTGGCGGCAGAGCTTCGACTGCCTGCCGGGCGGAAGAC
GCGGCCGATGGTTCTGCGCGAGCCCTTACGACCCTGCTCCATCCAGATCGAGGCTTGGCGCTTGCTCCAGCTCCCGGTGAGTCCGATGCGGCACTTTTCG
CCCGTGGTTGGGCTCTGGAATTCCACGTTGAGCTCGGGTAACGCTTTGATGGAGAACAGCTTGGCAGCCGACGCCTTGGCGTCGAAGACGTTGTAAGTGG
GGACGGGAGCCATGAGCTCGCGCTTCATGTGCACCAGTGGTCGGCGGTGCGGGTCACGCAGTGTCTTCATGGCGGACGACGTGCCCTGAATCCGGAACAC
GTCTTGGCCCCATTCGGCATCGCAAATCACGAAGTCTTCGTCACTGGGGAAGTCCCAGAAGCGGTCGTGGAGACGAAGAGTGGTGATGGCTTTGGCGCAC
AGTTCTGCCTCAATGGGCGCAAGCTGCTGGGCTTCCGGGAGCTTTGGGATGGCGGAGGACGATGCACAGCCCATTGCGGGGAAAAAATAGTTTGTGGTGC
TTTGAGCTTCGGGTACTGGAGGTACTTTGAAGAATGGTTTGCTTGGCCGGAGGTCTATTCGTCGACGACTTGAGGGCACTGGCCAGAGAAGACCGATCAA
AAAGTAATGACAGACCAGGGCAACTGACTCCGGGCTTGTGTAGGTCAAAGCACAGCTGAATTTCAGACATTTCAAATCCACCTGGTCTCCTTGGGAGTTA
CCTAGAGATGGTCAATTCAGCCAAACTCGTCTACTCGTAGGCCTATAACGTCAGTAATCTGACAGGTCTCCTCGACGAAGGATACGCCGATAAAGAAACA
TGCAGAGCTAGCT