Description :
From Genome Similarity Track
Location :
Scaffold_54:198242- 200995
Sequence
2753 bases(100 bases per row)
GGCATTCGTGGCCGTTGGCCTCCCATCGCCGTTACTCTAACCAAAGGGTGCTATTCCGTGCTTTGGTGCCTCCACGCAGTCGTGTGGTTCCGTCGCCCGT
GCATCGTGATCTCCTGATGAAGTGTCATCGACCGCGGTATCACGCTATCGTGCAATCGCGGTGTGGTTATGCTTTCTATGGTATTGTGCACGTGTGGTGC
ATCTGCGTTGTCCGTGTTATCGTGCTCTACGATGCCATCGTGCTCCACGGTGTGTAATCGTGGTCATACCAAGCCCACCCCCTGTGCATTTGGTGGGTGG
TCCGCAGTCCGTGCAATCGTGTTCTTATGTACGGCTGTCCTCCGTGGCTCGGTACGCTCAGGCTCTACACTGGTATGGTGCTCCGTGACTCGGTGATTTC
GCGTGGCAGCGTGTTCTCCGATGGTTAAGTGGCTAACCCACCGTCCATACTGTCGTGTTATGTCTTGGTGTCGGGGCTGGGCTGTCGTCTGTGTTATCGT
TAGCTACCCTAGTGTCGCGCACCGTGGATCGGTGAGCTCATGTTCTACCTAGGCATCGTGCTCCAAAGATTGATGATTTCTGATTTCCCGTATCTGAACT
CCTGCGGGCTCAGGTTTGGTCGGTTGACTGTGCTCCATGTTTACCCGTGGTGTTGTTGGAGTATTGTTTCTGTGCACTCTCACCGATACGTGTTCTACCG
TGGCTTCGAACGTCCGTGCTCTTCCGTAGCCCGTGCTTTACAGCATGCTGGGGTGTCTATGTATTTAGTTCCCTTCCGTGGCCCGTACGTATCTGTCATG
TTCTCTCCATCTGTTCTTTTCATGGCTGCGTGCTCTTTCATCTTTCACGCTACCTATAAAACTTCGTGGTTTGCATCGGCTAAGTCTTCTATCATCGTCC
ATGGCCTTCCGTGCTTCGTGTTGCTCTTCTATCCCATCGTGTACATAGTGTAGGTCGGTATTCCTTCGTGTTTCGTGTCCTTGCTTAGACATGTGCATCC
GCGCCAACTTAATCACAAACGCTGTTCCCATTTTGTTTGATGTACACAACGTATATTGTTTGATGTACACAACGTATATTGTTGGAAAGTTCACATAATA
TCTTAACGTCGCACACTACGCGCGCAAATACAAAGGAAGATGATACTTTTTCCCGGGGGCAGTGTGGGGTGCAGGGGTGTAAGCCACAATAATCTTATTA
TAAAGTATTCACATTATTATCAATAGTAATAAAATTGTGATTATTTATCGAGTGCTGATTTATTAATTATGTGTACTACTACTACTACTATTTGCAAGCA
AAAATATGAAATATTTTAAGAATAGTACCCACTCAAAACAGTTTTGTAGGTTTAAGTATTAGAAAAGTACTACGAAGCCAAAAGTATATTTCTAAAATTA
AAAAGTACTAAAGCTTCGATTGAGGCCGCAATATGAGTCACCAAAGTGTACAAATTTTATCAACAGCTCCTACGACGATATATTACGTGTGTGCTCTTCG
GCGCCTTCTACTAATGCTAATTAACGCGTACACAGGCAGCGCCCTTTGCGTCTCGTGGCGCTCCGCAGCTAGAAATGAAGGCAAAATCAAATTTGAACGG
CTCTTTTAAGTACGATGTGTAGTCCACATTCGGTGTGTACAACATACAATGTCGATTTTAGCAAATGGGGGCCGCCTTCGCTGCGCTCGGCAGCTTTTTA
GCGAATCGAGGCCGCCTTCGCTGCGCTCGGCAGCCAATGATAAAGCTCAAAAACCTGAGCGTTTCGTGTGACGGACGGACAGACACCGTGCTAGCCTTGA
TACTTTAGGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGGACATGAGGTGGCCGCAAATTTAGTGCTTCTTGGTGTCGCGTGTT
TTGTGGGCGTCGTTCAACCTAGTACGTCGTAGCTTCGTGGAGTTAACCACTTAACTGTCCGTAATCTCATGTGGCTTTGTACAATATCGTGGTTTGGTAC
GTTTCCGTTACCCCGTACTACAGGTTGAATGTCGTGTTCTTCAATGGGCTGTGCTCTTCCGTGTTCTACTTGGTTTCGTGGCTCTCTGTTCACCCGTGGT
CCACGCTGTTTGTGGATATGCGCTCTCTTTTGAGCTTATGCACTTTAGTACAGCCTCTTTCGTGGCTCCTAGCTATTCTCTGTTCTCAAACGTTTACGCG
GGCTGTACCGCTTTCGTGATACATAGGCATTCGTGGCCGTTGGCCTCCCATCGCCGGTACTCTAACCAAAGGGTGCTATTCCGTGCTTTGGTGCCTCCAC
GCAGTCGTGTGGTTCCGTCGCCCGTGCATCGTGATCTCCTGATGAAGTGTCATCGACCGCGGTATCACGCTATCGTGCAATCGCGGTGTGGTTATGCTTT
CTATGGTATTGTGCACGTGTGGTGCATCTGCGTTGTCCGTGTTATCGTGCTCTACGATGCCATCGTGCTCCACGGTGTGTAATCGTGGTCATACCAAGCC
CACCCCCTGTGCATTTGGTGGGTGGTCCGCAGTCCGTGCAATCGTGTTCTTATGTACGGCTGTCCTCCGTGGCTCGGTACGCTCAGGCTCTACACTGGTA
TGGTGCTCCGTGACTCGGTGATTTCGCGTGGCAGCGTGTTCTCCGATGGTTAAGTGGCTAACCCACCGTCCATACTGTCGTGTTATGTCTTGGTGTCGGG
GCTGGGCTGTCGTCTGTGTTATCGTTAGCTACCCTAGTGTCGCGCACCGTGGA