Description :
From Genome Similarity Track
Location :
Scaffold_33:198220- 208299
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13496kinesin-like protein
Phypa_INRA-310PPTG_13497phosphoglycerate mutase
Phypa_INRA-310PPTG_13498hypothetical protein
Phypa_INRA-310PPTG_1349960S ribosomal protein L6
Phypa_INRA-310PPTG_13500cysteinyl-tRNA synthetase
Phypa_INRA-310PPTG_13501calcineurin-like phosphoesterase

Sequence
10079 bases(100 bases per row)
AGTCTTCGAAGAGCGCACTGCCAACGTCTCCTTACGTGGGTCAAATACGTCGCGTACTTGCTCGTTGTAGATCTCAACGCAAGTCACACGTAAAGTGTAC
TCAATCTCACCTCTCCGAGCAGAAACTGCATTCATCAGCTCTTGTGCTATGCGTGGTAAAAGACCGTCCTGCTCCTGCAGAGCCGTTTTGCGCGCGGTGA
CATCGTCTTCCTGTCCAAAAATGGTGAAGGATTTACCAGCACCCGTTTGTCCGTAGGCGAAAATGGTCACAGGGAAGCCTTCCAGCGCAGAATCGACCAG
CTCTTTCGCGCGTATCTGCTCAAATACGTCCTCTTGGGACGCTGTTGAAGACAGGAACGTCTCGCAACGAAATGTGGCTGCGCGAGTGCGACCTGGATCG
GTGTAAACGAAGAGCTCTCCAGGGTTTTCAGGACTAGCTGCGACGCACTCTTGGTCGTTCTTGTGTTTATCTCTATTGTTGTTTCTGGGGGTACTGCCAG
TGCGCCCGGTGGGACGGACGTAGGGCCGAGCGCGCACCACCACGCGGACCTTCTCCTCCTTCTCCATGTTTTCCGTCTAAGCCAGCAAGAATTCCACCGT
TGCCTCCCAAATGTAGGGATGTATTTTTGGCATATCAAAAAGGAGAGTACGGGAGTTGGTCGTGAAAAAAATGGGCCAAGTCTTCAAACAGCCAGAGCCA
TTACAGTCGATAGGCATCGGAAGAGAATCAACTGTGGCTGTGAACAGTAGTCGTGATTGGCAGCTGTAGGGCATTTCATGACTTTGTCAAGGTCCTTTGG
CACTACATGTATATTCTCATTCTCAAGCTTCTCTTGTTATTTGTTGCTGGCAAGTATTGCATCTGGCAGAGGAGCATGACAGTTTTTGTCGCTTCAAATC
ATTCGGCAAACAACTTCAACTTCGATCCAAAATGATACCGAAAATGGAGGTGGCGATTTTCTCCTTGCAAAAGAGAGCAATGTAGGTGTATTTCCCAAGA
CGCTGTCGAAGCTGGGTTTCGCTCCGCTTGTATTGATCTCGACCGTGCCACTTCTACGACGTATCGGTGGTTTATTGCACAGTGGTGACATCCTCTTCGG
AATCCTCAAACTCGAGCGGAATGAGCTTGATGTCGCAGCCGTCCCGGTGCGGGCTCAGCTCAATGACCGTGTCCTCGTAGGACTGCAGATGCGGAACCTT
GGCCGCCTCACAGCCGGCAAAATATCCCATAAGACAGCGTAGAATGGATTCACTGCAGATCACCAGCACGTCGCGCTTCTTGCGCTCAAACTCCACGATC
AGCGAGCGAAGACGTGAGATGACATCCACATAGCTCTCGCCGCCCACGCCTGGGTAGCGATATCGAAGCTTGTCCTGCAGTCGAGCCGCATAGTGCTTTG
GGTAGAAGCGCTCGATTTCATCGTACGTGAGGCCTTCAAAATCACCACCTCCGAGCTCGTTGAGCAACGTTGTGGTCACGTAGCGCTTCAAGTTGCGGGT
GGGCAGGTAGTTTGCCGTTTCTCTCGAACGCTTCATAGGACTCGTCCACACTTCCATGGGGCGTTCGAGCTGCAGATTCTCGACGAAACGTGCAATGGCA
CGTGCCACCCGATGGCCCTCTGGCGCTAGCTCCGTGTCCAGACCAAGAATGCCCTGGCAGCTGGTAATGCTCGGACCAGGACGTACCAGCCAGATGCGGT
GAGGACAGAGGTGAATATTCTGCAGGAGCGACACGATGTGACTCTGCAGGAAACCCTGACAGTACCGTGCTTGGATCTTCTCGCCGGCGTTATAGACCTT
TACATAGCACGCATTGTCGCCATCCTCCGTGTCCTCCACGGTCTCGTAGACCTTCTGGTACTCGTGCACACGCTGTCTGAAATCTGCAAGTGCTACCTCG
GGATCCTTATCCTTATAATCGGCGTTTAAGAGCTTTCTGCAAACAGATACACAGTCAGCTGACCATACGATCATTGATCATTTGCTTTGCAACGCACCGA
CGGTAGTTGGCTTCGAGTAACGCTTCATTGTCGCAAATGCTCTCCACAAACATGACGCGGACGTTGCGGTGCGAGCTGACCTTCTCAAGAATATGTTGTC
TGCAGAAATTACCACGACGCAACACGCAATATTCAGCCAAATTTCACACTACTCCATCCATCTCGTACGTACCTGCGTAGCTTCGTCGTGTTGGTCGCGT
CGAAAACCGCGACGTGTCCCTGGGTATCGAGCCATTCGAGCAGGTCGTCCAAAGCGTCCATCGCCATCTCTTCGCGCAGACGTGTGGCATCTGAGTTGTC
AGCGCTGAAGAAGTTGGCGTTCTCGCCAGCTTTGCCCAATTTGCGGCGTAGGTTGCCAACATTGAACATGCGCGTGGGGAAGCCCAGCCACTCGATGTAG
CGAAGTGTCTTGTGAACCACGAAGCTCTTGCCGCGCGCTGGTAGACCCACCATTACGAGCACGAGCTTCTTCTGCGACGAGATGAGGCCGTCCGTGCTGC
CAGTACCGTCGGCGCTCTCTTCGCTGCTGTCACTGTCAATGGATACGGTGTCACCTTGCGGCGATTTCTTCCACATCCACTGGGACTTGCGATCATCACC
AAGGCTGTTGAGGCGCTTTAGCCGCTGGTTTGCAAAGCGGCGGTGCATGGTCTTGTACACCAGTAGGCGCTTGCCACCGTCACGCATAGCATCTCGCAGC
GTCTCGCGATAAATTACCACTTGGAGGGCGAGTGCAAGAGCGAGCGCCACGGACCACCCAGCGCCTCCCGGACTCGGAAGACTAGGAAGATTCAGCTTCA
TGCGAGTGTGGACTGTTAGATGATTGAGGTCGATTGAATTGTGTCGCTGCTCGTCGTGTGCAACGTGAGCGCGTTTTTGCCAAATGACCGCGCGTGCTGG
AAACGTTTCTGTGTCCTGATGAAAGTGACCGAATGAGATGCGCAGAGACATGGAATAAGATTTGAAAGGGGACAAAATACCGGACACGTGCAAAATGGTT
TTTGCTGCTGACGCCGGTGGATGAATCTTGATCTTCTTTAAGGCATAATCCCCTGGGTTGGAAAGCTCCTGACGCACGTGGCGAGACATTCCGCTATGCA
CAAGCAGCAGCGTCAGCAGCACTGCCAACCGCGCGACGCGGCTGCGACGAGGATACAGGTAAATTTGAGGATTTAACACTGCGGAATCATGTGCGAACTC
TTTGATTGACGACCTGCATCTGCACGCCAAGGGCAGCGTACCTTCCGTGGATGGAGGGCTCGTCGCCGCATCGTGTACCAAGTGCGCGAGGACACGGAGG
TTCTGGTAGCTGACATCCAGCGCCAACTGAACGGCGAGTGGGCGCTACTTGGGCCAGCAGCGGCAACGTCCTTCTCGCTGGACTGGGGGTGCGACGGCAT
ACTGCGGCTGCCGCGCATAGAAGACTCGCTCTTCGGTATTTCAGTGCGTTTTCCACTGGTCGAGTTAGAGGAAGAGCAGGTTATCGACGACGCCGAAGCT
GCAAACGAATATGAGCGAGCTGCCAGCGTAGACAGCGGGCTGATAGCAATTGATACAAGTAGTGAATCGCAACAGGACAAGGCGATGCCGTTTGAAACGA
CTCTTGACAGTGCGTTCGAGAACTGTCCACCAGCCGACGACACTGGCGCACAATCTTCGCAGGGGACTATTAGAGCCGAGGCTGCGAACAGCTCCGATAT
CAGCAGCTGTGATGCGTGCGTGTCGGCTGTAGAAACACGAAGCACCACGCTCCAAGCAGAAACGTCGGCGGAGGAAACGAAGCAGCAGTCCGAGCGTCAA
ACGGAAAGCATGGACGGAGCGCCACTGCAGCGTGGCAAAGATGGGAATACCCAGCTGGCAAGCGTGCAGGAAATCATCGTGACACACTCGCGAGCTGAAA
TCTTGCTCGAGCTTGAGTGGGCACGTCAAGCACTGCGCGACCGGCGTAAGGTAAGTGTGTTCAGCGCTTCGTCAGTGGCTCGCCAAATGTCTGAATGCTT
GCTTATCGCGTCTTGCTTCACAGTACCTGCGATCCAAGAGGCGTGTTGAACGTGGCACGGATCCGTGCGCATGTGCATAATCCTCACGAGCACTAAAGCC
ACACACTGTAGTTATAAACCATTCCGTAAATTTGCACGTCATGACACCATCGCCTCAACCTAACACAAAGCTTAGAAGCGCATATCGTGCACACGATCGT
TCTTGGTCAGCGTGAACTTGGCATTCAGGTACGCGCGCAGATACGGCTCGTTCGCAAGCTTCTTCAGTAGCAGAGCGTCCACTATTTTCTGGTCCTTCTT
GCGCTGTTCCGCAATTACTGGCGCGGTCTGAACAACACAAGAGCCACCGTCAGTTCAACAGGTGGAGGAACTTTTGCGATCCCAAGCGCTTTTGCAAACC
CAACAGCCTCATCCATCAGCTCTCATAGGGACCACGCATATACACAAGAGGATACGTGCAGGTAAGACAACTTAGTCGTCAACGTACCGAGGTTTGCTGT
GCTGCAAAGAAGCGTTCCTCCTTGCTGCTCTTCTTAGCCGGCTTGTCCTTCGTAAAATACTCATCGTCGATCTCCGGAAGCTGCACGTCCGACAGATCCA
TTCGAGTCGACGTAGCAATGACAAAGGCCTGGTTCACACGACGCAGTGGCACACCGTTCACCTTGTACGGGCCTACAGTACACAGTAAACATCATCCTGT
CAGCATACGTAGCTGGTAGCATCACTTATCGAAGACTCAGAGCCGGCATTATTCAGGTATAATACTCTGATGGATCGTTGACTCGAAGTCATCACTCTTC
CGTCCAAAATAAGTGCTGCAACTTTGACTCACCCGTGATGAGCAGTGTGCCCGATGGCAGCTGCTTGAGGAAGACCACACGCTTGCCGCGGAAGCGCCCG
GAGAGCAGAATAAGCACCGTGCCGGGCGTAATGGACTTGCGTAGCTTGGCAGTTTTGACGCTGTTGCGTTTGGTCTTGGCGGATGGCAGCGGCTTGGGTA
TGTAGTCGGCAGGATACCACTTCTTCGTTGAGTGTGTGGTTCGCGCGGGGACCTTCTGGGCCATCACCTTGTTGTTGGCGGCGCTGTGGGCGAACACACG
ACCGTTGGTCTTGGCCAAGCTGTTGGAGGAGATGGCATTAATGCCTCGTGCCAACTCATAATTGGAGCGCTTCATGGGTTCTGTGACGGCCATTTCGCGG
GCGTTTTCTGCTGAAAAATATGAAGCTGAGTACTGTTAATTGCGCAATACTTCGGAGAATAGGCTGAGCAAGGAGGTGCTGCTTCGTAGAGGATCACTAG
AGCAGCCTCGCCGTACATTAAGGCTCCGCCTGGAGCTTACCTGCTGCTTGTGACTGCTTTTTGTCGAATGGACCACGATCAACTAGAAAAGATTTTCATC
CAATTAGATGTCGTGAGAGGGAAAAGTTTTTCTACCACTCACATGTCGGAAGAATGAAGTGCTCAAATTGTTCAACCCAGTGTGCAATTCTACATGTTCT
ACTGTACAGTACATGTATCCGATAATGCGTCGAGCTTTGCAATCAGATCGCGCTTGTTTCGAAGGTTTACAGGCAAAGCAACGTTACTGCAGCACTACGC
AGTCTTAACACAAATCAGCCATCCAATCGACTACTGCAGGATCAAACGCGTTTCTCTTCTTTCTAGATCTAGTTGCTGTTGTGCTTCTCGTAAAGCGCCT
TCTGCTTGGCTTGTTCCTTTGCCAACTTCTTTGTTTGGCCCTTGCTCAACGGCTCACCAGCAGCATCATGAGTCGGCAGACCCTGCAACACATACATAAA
TAAGCCTGCTGTACCCCACAAAAAATCATAGTGACAACACTTACGTTGTCGTCGAACTTCGAGTACTTGTCCTTCATGCCCAGGAACATCTCGCTGGGCG
GAATCTTGGCCTTTTCAGCCAGCTCCGCCTTCTTACGGGCCTCTTCCTCCAGTCGCAAACGCTTCTGCTCCTCCTTCCTGATCTTCTCCTGCTTTTTCTT
CTCAAGCTCTTCAATCAACTCGTCCTTGTTAGCCAGCTTCCACACCGCAGCACCGGTAGAGCGGTCCTCCAGACGCACGCCAGCATACGGCAGCTTCTCG
TCACGCACCACATCACACAGACGCAGCACAGCGCTAGCCAGAGCCTTCGGGTCGCCACCTTCCGCTGCTGCAGAGCGAGCAGCCTCGCGGATTTCATCAC
GGAACTGCGCAAAGATGTCCAGCACGGGCGTAAGGACCGTCTCCTGGTCAACACCGCCAGTGGCTCCCGAGCTAAGCGGGAATCCAATGTCCGTAGCCGA
CGTTACAAGTCCAAAGATCGACAGGATGCGAGTGATGTACTCGGCGCTGGAGCGGATCAACATCGAGGCCTGTTTCTCGATATCTCCGGCCATGTAGCGG
TTAACCTCCTTAGCTAGCTGCTGCAAGTGCAGCAGCGCCAACGGCGTGTTGATGTCGTCGCTGAGCGCACGGAACACCTTTTCCTTGCAGTCCAGCAGAG
CTCCGTGCAGTGCCTTCTCCACCGGTGTCCACTTCTGAGTCTTCTCCACTCCGAGTTCACGGAGGCGAGCCTTGACATTAGCGAAGAATTCGGTAAAGAA
GCGGTCGACGCCGACTGCTTCGTCCATCGAGTTGTCGTTGTAGTCCATGGGCACGTTGTACTTGTGCAGCAAGAACAGGAAACGCAGTTGACGCGGTGAG
TTGTCCATCAGCGCCTCCTGGATCTTGACAAAGTTCTTCAGACTCTTCGACATCTTCAGACCTTCAATGTTCAGGTGACCAGTGTGCACAAAGTAGTTAA
CCCACTGCGAGAAGTCAAAGTACGCCTCGGACTGGGCGATCTCGTTGTCGTGGTGAGGGAAGCGCAGGTCGATGCCACCGGAGTGGACGTCAATCTTGCC
ACCAGCCAGATGTTTGAGCGCATCACTCGCCATGGCCGAGCATTCAATGTGCCATCCAGGGCGTCCCTCACCCCAAGGTGACGGCCAGAACGGCTCGCCG
CTCTTCGACTTCTTCCACAGCACAAAGTCGCTGGCATTGCGCTTGTCCGACTGTCCAGCTGACAGCGCGCCTTCACCTTCAGCCAGCAGTTCTGATTGGC
CGACGTTCTCGGGCAGCAGCTTGCCGTATGCCTTGCCCTTGGAGCGTCCGAAGGCTGCCGTGTCAAAGTATACCGAGCCGTTGCTCTCGTAGGCAAACCC
GTTCTTGATGATGCCCTCTACGAACTCAACGACCTCAGGCACGTACTCACTCACGCGGGTGATAACTGTAGGGGTCTTGATGTTAAGTGCAGCCATGTCT
TCCAGGAAGGATTTCTCCCAGAACTTGGACAGCTCATGCGTGCGTCGCATGTTGTCCTCGGGAGGCTGCTGGGAGGCCCACTCCATCACGAGTTTGGCCT
TCTCGTCCTTGTCCTTGGGCAGCTCCTTGCCCGGGTTGGCCTCGAGCCAGCCGGTCTCGGAGGCACGCAGGATGATCTTGTCGTCAATATCCGTGATGTT
CATGACGAGCTCCACCTCCAGGCCGAAATAGTCCTCCATAATGCGACGCACGTAGTCAAAGCAAGTGTAGGTGCGTCCGTGGCCCAAGTGGGTCTGGTCG
TACACCGTGGGGCCGCACATGTACCACAGCACGCGTTTACCCTGCATGGGTACAAAGGCGTTCTTGGTGCGGGTCATGCTGTTATACAGGCGCAGCGGGT
AGTGCGTGTTCCAGTACTCTGTGAGACCCTCGATGGGGCGTGGTGGGTACCATGTGGGCTGCTTCATAGCGGGGGAGTCGGGCGTCGCGTCCGTCATGGT
CGTCACTAGGGTCCGCGTAGCGCTCTGTGCGATTGACTGGAGTCGGGTACGTTTCTAGGTTTCTGCTTGACGTTCATGGAGAGAGTGCACAGATTGGTCG
GAATTTGGAACGAGCGGATTGGCAGAAAAAGCTTTGAACAAGATTGAAATATCCAATTATTGGATATTATCCAACCGCGATGGTAACTTCGTTGATGCAG
TAATTGCACTCGTTTCATAATACAACAATTAAGCGAAGGAAGATCGTTTACTTTTCTTGAGAGTTATTGTGACTATAGCTGACTGCTCAACGCCAATGGT
TCATTTACCATATCACACTGGCTAATACTTCGTACAATCCACACCAGCATCAGAACCAATTCTCGTGTCGAGCTCAATATGGCAGAGGTGACGTTGCAAC
TGCGGTACTTGCGTTAAATGTCCGACGTTGTGAAGAACTGCGGTCGAGAAGCTGCCAACGCAGCTGAGTCGGACGATGCTTTAGCAACTTTGACACCTTC
AGATAAAAACCTTTCGTCCTTCAACAAAAGGATATCTTCTCCTTGAAAAAACAAAACCATCGGTTTTATGTCGTTAAACCGAGGATCTTCAGTTCTGAAT
ATTGAGCTGACCAATTACCATTGATCTAGCAAAAGATTCTATATCATACTATCCTCCAGTATCTCGCATCTGTAGTTTTTGTGAGCCATATTGTGGCGAA
ACGGTGTTGCCTCACCAGCAGGTGTTGTTTGTCTCCAGCAGTCTCAAATCCGCTGGTGTCCGACAACATGGTGGCGTCCAAGACTTCAATCCTGCTGCTC
TTACTGCAGGCTGTGCTGACCGCCAGCATATCTTCGCTCGTTGCACCTCCTCCTCCGCGCGCTGCCGTCGTAGCGCGCCAGCAGGAGCCCGAAGACTCCG
ATGACTTTGAGAAGCGAGAGGTGGAAAACTGCGTGCCGTACGACATCCGGTCGTCCGTCGTGGGCAGACGCGCTGTGGTGGAGTGGGCCACACGACGCAC
GTACATCCGCAAGGTTAAGCTACAGAAGTCGCACGACCCGAGCCCTGTGCTTGCCAACCCGTGGCGCTCATGCCACGATGTCGCCGCTGACGTGGTAGTG
CGCTACCGACGACTGGGCGATAATGATACCATGCTCGTCAGTGGAGACAGAGAGGCACCATTCACCAGCAAGGAGGCAATTACGTATACGACGGACGAAG
CCACGTTCACTACTCATACGGCTTTCATCAACCTCCCGGAGGGAGAACACGACGCGGGGTATGAGTTCATCGTCGGGTCCGTATTCCACGGGTGGTCGGC
GGTGCATCGTTTGGGTGTCAATCTTCCGTTCCGAGGAGACGAAGCAGAGCGATGTCGACCGAAGCACGTGCACACGGCGTACGGACGCACACCGGGCAGC
TTGGCAGTGCAGTGGATGACGAAGGAGTTTTGCGGGAAAGGAAACGCTCAGCTGCAAATGGTGGAAGGCTACCATGCCCGTATCGAAGTGGAAGGACCGA
ATGCAACCCCCGTGACGGCCTGGGCCAACACGACACTGTTCGAAGACGATGGTGAGAAACAGTCCAAGCGCTGGCTGCATGTGGTGAGACTGGAAGGACT
GAAGCCAGACACGAGATATACCTACGTAGTGGGCAACGCATACTACACGTCGTGGTCTATTCCTTATGTAACTAAGACTGCTCCGGCTCCGTTGAGTGCT
GGAGAGAAACCCAAACCAACGCGATTCTTGGTTACTGGAGATATCGGCTATCAGAACGCAGCCACTTTGCCGATGATGCAGTCCGAGGTCGCAGAAGGGG
TCGTGGATGGTGTGGTGTCCGTTGGTGACTACGCCTACGACTTGAACATGATCGACGGTCACGTTGGAGATATCTTCATGCAGGAGATCGAGCCGATTGC
TGCGAGTGTGCCCTTTATGGTGTGTCCGGGCAACCACGAGACTCACAACGTGTTCAGCCACTACTCGCAGCGCTTCCGACTCATGCCGAGCAATAAGAAC
GAAGGTGTGCAGACTGTCCATGTCGGTGGACGCTCGAAGGATGCAGAGCCCAAGGAAGTGCCGAATAACTGGTTCTACTCATTTGATGTGGGGCTGGTGC
ACTTCGCGATTATCTCCACCGAGATTTACTTCAAGAAAACGCTAGATGTGGACGGAGACGTGATCGCCCGACAGGAAGCCTGGCTAGAGCAAGATCTTGC
CAAAGCCAATGCAAACCGTGAGCAGACGCCTTGGCTTGTGGTGATCGGACACCGCCCCATGTACTGCACCTCAGACGAC