Description :
From Genome Similarity Track
Location :
Scaffold_157:19821- 23360
Transcript NameFunction/comments
Albla_Nc14086620Cullinassociated NEDD8dissociated protein putative

Sequence
3539 bases(100 bases per row)
CACGTAATGCACTCCGAATCGCGTCGCGGGTACGTTCCAATTGCGTCCCAACCTGGTCTTCCGTCACGTTTTTATTGATCGTTTTCCTTAACGCGGTGAG
TATCACTGGTACACTCTGAACCACACAAATCGGCTTCACTTGACACAACTTGCTAATAATACCGTGACACTGCATCTGGATATCTTCTTGATCACTCAGT
CCCTGCTCAATCACCGAGTCAAACACACTGCAATCGAGTACATTATGAGCTTGTGTGGTCAACACCGTTTCCACACATAGGAAACCCGCTTTCCGCACTG
CGACTCCATCGTCCACTTTATGCTTAAATGGGCCCAAATCCACAACCCGTTCGCACTTGACAGTAAGTGTACGTAGAACCCGTTCCATGAGATCTTTTAC
GTAGTCGTACACCAAATCAGGATAATGATGCAGGAAAGCATTTAATGTCATTAGCGCCGCGCGACAAATGAGGAAATCCTCGTCATTCAGCGCGGTACGG
AGAGGTTTTGCCTCGCAGAATACTGCCTGGATCACCGCCGCATGCTTCTCCTCCACGCAAGGAATCGTTATCGCTGCTCGCAGTGCTGTGATCGCCGTCC
ATCGCGCTCTATTTGAAGCATCCTTACCATTCATTTCTTCTAGATATTTTACAGTATCGCTCGTTCGGATAAATACGAGCTTTCCAAGACACTCTGCGAC
CATATTTCGTATTCCTTCCTCTTCTGAATCACTCCATCGCTTCAAAATGGCTAAAATACGAGCGGAAGGACCCATCCAGTCGCCATTCAAACAATTCCCA
ATGGCTTGACGCAACGCACATAAGGCTAAGTACGTGTGCTCATTTCCTTCCAACTGACTCCAAATCAACTCCAAACATCCACGGTTATGTGGATTACATA
AATTACCCAAAGTGAACGCTGCTGCCGTTTTCATTTCCTCGCTTTCCTTTGTAAAATACCGAAAGATTGATTCCTTACCATTCTCAAAATTCTTCCATAT
GACACAATTTCGACCGATTTCGCCGATGCAAAATAACGCCAACATTGTATTCTTCTCGTTGGATGCATCATGAGCAGTATCCAATTGCTGCAAACAGCTT
TGTACCACAAAAGAGCGATCCGATTCGGAGCAATTTGCACACAACGCCGCCACACAGCGTGCGATATGGATCAGTGTCTGCTTAGATACGTCTGGAGAAT
CGCAAAGCGCCTCAAATACCTTCGGAACACATACTGAAAATTTCGCGATTTGCGTAAAATACCGTTCCACGGCGTCTAAACATTCGTCTTGTAGCGTGTT
GGTTTTAGCCAATTGCAAACAGTGTTCCAAAATCCTCTGAAACATGATTTCATCCACATGAATCGAGGTCGTGCGCATTATCGCACACACGAATTCAATC
GCCAAACGACACAACTGAAAATCCGAGCCATTTAATAGGACACACGCTTCCGTCAATGTAATTTCAAGTAATCCGTGATCCAATGCTGCACCTTTAGAAC
AAATCACCTGAATTAGTGTCTGCAACACAATCTGCTTCAACGTTCGCGATTGCTGTCGCAATAAAAGCGCTAAATTCTTGACCACATCGCTTTTTATCGC
AGAAATGTCGATGCTCTCTGAGATGCTGGCGATCGCTTTCATAGCGTGTATCCGCGTGTTCTCGTTTTTGAGAAGATCCGATAAAACTAGCAGAATCTCT
TGCTCTCGACCACCCAATTCTCCCGATAAACTACGCAAAAGTCGACCTGCTGCATGAATTGCGGCTTCCTTGATCTCTTGATCCGTGTCCTTTGTTTCCA
AATGCGGTAGTACCGCATCCAGCAATAGTGGCGCATAGGTTGATGCCAATTGGCTATTTTCGATCACGCGGACCAGTGATTGGATCAATTCAAGAGCTTT
CGCCACCACTTTGTACCATTCTTTCTGTACACAATCCACACAGTGACACACTATTTGAGGTATAAACTCATACACACTTTCAGGATTGTGTGTGTCGATC
AAAAGACGCAACAGTGTCAGTGTTTCCAGCTTCAATTCCGTGTGCTTGTCCTCCAACGCGTGGAGTAATTTCGGAAATAACACTTCAAAATGACAAGATA
ACTGACCTGAATTCAAGTGTGCCACTTCACATAACATTTGCAGTAGTGCGCGACGACACGCAATGGACGTTTTCACCGTTAAATAACGTGTTGAATAACT
GATAATAGTTTGTATCTGTTGACGAAAGGAATCCACGACTTGTACATTGCGATTGGAAAGCGTGTGGAGAGCGATAATGAATTGTAAAAGGGCTCTAAAC
ACATCCACGCGAACGTTCTCTTCGCGTTCCTTTAATCGATCGATCAGCTGTTCCATCACACGCGTTTGAATACTCCCAAATGACTCGGGTCGTGTCATCG
CCACAATTAAGACACGAACGCTTGCTCGACGGACTTTCCAGCTGGTATCATCATCATCACTATATTCTTGCTCGCTGAATTCCTCTTCGCTATCGTTCAT
TTCTTCGTCTTCATCTTCGTAATTGTAATTGGGATCGTACGATATGAATTGTAACAAAACCGTTATGATATCAGTTGTAAAGTTTGATAATTGTTCGTGA
CAATTCGTGAAAAACGATTCAAATGCTTGAATGCAATTCTCACGAAGCTCATCGGAATTGCCATTCTGCATGGATGTATCGTCCGCATTTCCACAGAATT
GGATCAGAAGCGGGATAATTGTATCGAAATGAGCGCTCAGTCGGTGTCCACAAGTTCGTGAGAGCGTCCCAATCGTTTGGATAAGTGTTTGCATATCCGA
ATTCCCGCTGCCAATTCGTTTCCCCAATCTATCAATTAAGTGCGCAAGCAATTCATCGGAAATAACGAGACCCAAAGTCCCGATACATTGAATAGTGCGT
TTTCGTATCAGATACGATGGATCGTTCAAATCTGTTAAGAACAATTTCAGATAAGTTTCATGATCACTGGCGATACAATTTCCAAATCGACGAAATACAT
CCGAAACGGTATCCAAAATATCGGCTTTGATGCGCGTCTCTGAATCAGATCGCGATAGATGATACAGAAATTGTGCTGAGATCGTTTTGGACAATAAAAC
ACCCGCAGAGATGTCGATATCCGCCAATATCGTCTTGATACCGATTGTGTAGATATCGTGCAGCTCTTCCTGCCCGTGAAGGATCAGATCGCACAATTTT
CCAGCGATATCAGCAGCTTGGCGATCGCTTACTTTAGTGACCAGAATTCCCAAACTAGGCAAAACGGTTGTGATTTATTACATTTGTAGACTGTGTTACG
TACCATTTTACCGCAATGGACTGAACATCATTCGAAGTATCGTTCAATTGGTTTAAAATTGCTGTGCAAACCCTACACGCCATATCATCAGCGTTTGATT
CGTGGAAAACGCATCCTACGTACTTAATCTCCAACTGCGATCCAAGCTCGACCGAACCTTTCGATAATTCCCCACACAAATCCGAAGTCGCCATATACCG
CTCATCTTTATCAAAGGTACTGCTCTACGCGCGTCCACA