Description :
From Genome Similarity Track
Location :
Scaffold_197:19811- 22997
Sequence
3186 bases(100 bases per row)
CTAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGA
AGTTCGTTGCCATGGATAGGAACGACTTCTCTCATCTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGGGGCCCTGCT
GAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTTATCGCGCATGTGCGGGAGAACCTGCAG
GCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGATGGCGAGAACCTTCATTTCTGGGTCC
GAGAGGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGT
GTACACACGGGAAGCAACATCCCCTGGATGATTCACATCCTGGGCTCAGCTGTGTGAGCAGCTCCGAGCCGCGTTCCTCCCCGCGAACTACGAGTACCGT
CAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGAGCGAACTGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCAC
TCAACGAACACATCTAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTAAAGAGGC
GATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCCTTGTCGGCTCCCGGCCGAACAAGC
CCCAACGGACCAGTTTCCATGGAGCTCAGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCAACTGTCCCG
CGGAAAGACTCCGCAGACGGTCCTTCCTCAAGCCCGTCCTCAAGGGTCGCTGGAAGAAGCCAGGATCCCGGGGACATTGGAGCGCCGGGAACCAGTAGGG
GCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTAATGGGTGTGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAAT
CGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGTCGTGTACGGGGATACGATCATCCTTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTT
CGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGTAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGG
AAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAACTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCAATATGGATCCATATG
ATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGAATCGACTGGCGAGGCAAGGCAATCGGTTCCAGCCGCCCTGCGCAGTCCGACAGAGC
ATTATTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCAGCAGATGCTTGGGAGTCGTCGACGTA
TATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGAGCCGGCCCACGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAG
ACAGCTGCAGCTGTCATGAACACCGAGAACAGCGTGTTCAGAGTGGGTGACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCG
GATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGTTCGTCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGAGTAACACAGT
GCCACACGCGTTCGTCCAGACCTTAACTGAAGAGGAAGACGTTGAACACGCTTCCTGTGTGGGTACCACAGTACCCCACGAGGCCACGAGTGCCTCGGAT
GTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAATCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCG
TTCAGATCGATGTTGCTTCAAGCGAATCGGAGTCAAGGGCCCGGGCTCCTTCGACAAGGCCGGTGGAAGCGTGTTATCACATCTTCGATGGCGAGACCGG
TTTGCCCGTCAAGGCATCTGGTGTCAACTTGAAACCGCTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAAC
CTCAAGGCTGGAGAGATTGCCGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAG
ACCTAAACAAGCAGCGTCAGACGTGCTTGGGCTCTAAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGAAGAGTATGCGGACGTGTTGAGC
AAACACCCACCGACCCAACTCCCACCGAATCGAGGCGTACGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATT
GATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCATAAGCCGAACGGAAAGT
GGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCACTCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGTG
CGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCTGCTCACTCCAAGCGGCATGCTTTAAGAGTGG
CTCGTCATGCCACAGGGCTTGTCTAACGCCCCGGCGACGTTCAAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTCCTTC
GACGACATATTCGTCCATAGCCGTGCCGGAGGGAGGCAAGGACGGCCATGGGAGGTGCACCTAGGGACGCTTCCGTTCGGAGTGTT