Description :
From Genome Similarity Track
Location :
Scaffold_64:198106- 200746
Sequence
2640 bases(100 bases per row)
TTGACCTTTTCAAGTGCTTTTGGCAGTTCCCACTGCACCCGGACAGCTGGGACATGTTGTCGTTCATGCTGAACGGATGTGTGTACACCCCAGACCGAGT
GATGCAAGGCCATGTGGACAGTGCCCTCTACGTGCAAATAACGAACGAGGAGTGCTACAAAGACCTGCTCTACAAGAACATGCTGATCTGGATTGACGAC
ATCTTTGTGCACGCCGACACAGTGGAAGCGTACGTGGATGCCATTGAGTCGTTCTTCGATCGAGTGGCCCAGTACGGGTTCAAGCTGAGTCCATCCAAGA
CCAAGCTGTTCACGGACCAAGTCAAGTGGTGCGGACGCATCATGAGTGGTGATGGCGTCAAGCAAGACCCTGAACGCATAGAACATCTGTGTGCGATCCC
CTACCCTACGAATGAAGGAGAATTGCAGCAGTTTGTGTGCGCTGTGAACTGGCTGCGGGACTCGATGACAGAGTACGCACAGACCGTCGTCCCACTGCAG
CAGTGTCTGACGAAGGCCCTCGAAGGCAGGGGCAAGAAGAAGTGGATCGCGTCTGGTGTTCAGGTGGACTAACCGATGGCGAGAAGGTAGCGTTTGACGC
CGTGAAGTCCAAGCTACGATCATCGGTGGAACTGTCTCACCTGCGTGATGACGCCACGATGTGTCTGTTTACGGATGCGAGCGATCATGGATGGTCGTTG
TGGTAACTCAAGTGGTGGCATTCGATGATGACAGCCCAAGAACAACGTCATGAACTGCTCTTATGTCAGTCGGGGATGTTTGCGGGCGCCCAAAAGGCGT
GGTAATTCATCGAAAAGGAGGCCTACCCTATTGCGCGTGCGTGCGAGAAGCTCAATTATATGCTTATGCGGCCGACGGGGTTCAAGATGTACTGTGACCA
CAAGAACCTCTTCCATGTCTTTGCCCCGGACGAAGAATGGAAGGCGCACACACGCGGCAAACTTATGCGATGGGCTGCCATTATTGGCGGCTATCGTTAT
GAAATTATACACATCGACGGCATCCACAATCTATGGGTGGATATGATGAGTCGTTGGGGTCAGCCGACACCAAGTCTGGCGACCAGGCGGGTCAAAATAC
GTCGGGGCCATGGCTGGTCAAAGAAAGTCAAAACACGCAAGTTCCCCCACCGGCACAACCAAAACTGCGGCCGATGGACAAGGACTTTGTGTGGCCATGT
GTGGTGGACATCCGTCACGCACAAGACCAGCATGGCGCAACCAAACCAAAGCGAGCTACTGTGGTGGAAGGACTGTGGCAAGTGGACGAGCGGCTATGGA
TACCGAGTGCGGCGAATGACCTGATCCAACGGATCATGGTCGTTGCCCACTGCGGCAGCACCGGGCACCGAGGACATGCAGCGCTGGTGGCTACTATCCG
CCGCCTGTTCTATGTCGACCACTTGGCCGACAGGGCCAGTGAATTCCTCCGTGGCTGCTTGTTGTGCCCTCATGTAAAAGGGGGAAGGGTGGTCCATCGA
CCGTATGCTCCGAGATGGCACGCGAAAGAGCGCAACGAAGGAATCCACTTCGACTACCTCTACATGGGCGAAGCGTTCAGCGGCGCTAAGTATGTGCTGG
TACTCAAAGACGACCTTACCCACTACTGCGAACTCATTGCATGCGACGGACCCACGAGCCAAGTATGTGTGGATACCCTGGTGGACTGGACGAAGCGATT
CGGAATGCCATGAGTCTGGGTCAGGGACCAAGGAACCCATTTCAAAAACGTGGTCATAAAGGCGCTAGCCCACAAGTTCAAGGTCCATCATGACCTAACC
TTGGCCTACTGCCCCTGGCGCAATGGAACGGTTGAGCCAATGAACCGCGACATCCTTCAAGTGATGCGGGTCATGCTACGAGAATACCAGCTAGCCGAAC
AGGAATGGGACTACCTATTGCCAGTGGTCCAAGCCAACCTCAACCAAACACCGGCAGCATCACTGGCGAGCAAGTCGCCGATGGAGTTGTTCACGGCTTT
GAACCCGGCGACTCCCCTGGATGTCGTCGTGGTGGGCATGAACAAGGAACTCCGAGAGAGCACTGGACGGTCGAGGACATCCCCAAAAACCTGGACAAGC
TGCGTGCTAACCTGCATATAATGCACAAAGAAGTCCTAGACAAGAATGCGATGCGCGCGGTGAAAGCGACGAAAGCGACCGGGAAATATGAACAATGCAA
CGTCAGCGAAGGCGAATATGTGCTCTGGTCCCGTGTCGACGAACACGTTATCACCCCAAGTTGCTCGTAACCTGGACGGGCCCCTACCGAGTCAAGGAAG
TGGGCGAATTTTCCGTCGTTTTGGAGCACTTGGTGACCCACGAACTGCGGGAAGCGCACGCATCAAGAGTCAAGCTCTACGCCGAAGACAGCTTTGAAGT
GACCAAAGAAATCCTCGAACACGTTTCCGAGCAAGGGATCATGCTGAAGGTCAAGCCCATCGCGGGACACAAGTTTGTCCCGGATGTGAAAGACTTCATG
CTGTAAGTGATTTGGGAAGGTTTTGAAGATATCGAGTCCTCATGGGAACCGCTGCAGAAGCTCATGCATAAATGCCCAGCCGCGGTGAAGAACTATGTTG
AAGGCGTGAAGACAGCGAACGAAGGCGATGCATTGCGCAA