Description :
From Genome Similarity Track
Location :
Scaffold_131:1981- 3610
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_131-fgenesh-gene-0.6Myosin

Sequence
1629 bases(100 bases per row)
CAAGTTCATCGGCATCCTCGATATCTTCGGCTTCGAGAGCCTCGACCGCAACGGCTTTGAGCAGCTGTGCATCAACTATGCGAACGAGCGACTGCAGGCG
CAGTTCAACGAGTTCGTGTTCATCAAGGAGCAGGACGTGTACGTGTCCGAGGGCATCGACTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCGTGTCTCTCGCTGTTTGACGACAAGGCGAGTGGACTGTTCTCGTTGCTGGACCAGGAGTGTCTGATGCCGAAGGGGTCGGACGA
CGCGCTCAGCACCAAGTTCTACCGGTACCATGGCGGCAACGAGAGTGCTGTTTCCGGTACAGCTCTGCTGAAAAACCAGCAGAGTGTGCCAACGTACTCG
CTACCGAACCTCGTGACCTCGTTCGGGAGATACTTACACCAGCCGTCGGCGGCGGCATCATCGGACCCCATTGAGCGCGAGCCTGAGCCAGAAGCAAAGG
CGCGAAAGCCGTTCTACGCGTCCAAGATGGACCGCGTCAAGCACCAGTTCGTCGTGCACCACTTTGCGGGCAAGGTGTCGTATAAACTCGAACAGTTTGT
GGAGAAGAACCTGGACATGCTGCCTACGGACGCGACGACCGTGTTCAATGCCTCGTCTAACGCGATCATGAGCGCGATTGGCGACGTGGACGTGATTGAA
CAAGTCGCGGAGCGAGCACCTGGACGCCGACGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTCTGCGCAGTTCAAGAGCCAA
CTGGATCGCCTCGTGGAAGAGATCGGGTCCACGGAAGCCCACTATGTGCGCTGCTTGAAGCCGAACGAGGTCAAGCGCCCTGGTATCTTCGATCGCGAGC
GAATGGTAGAGCAGTTGCGGTCGGTCGGTGTCCTCGAGGCGCTACGGATCGCGCGTGCCGGGTACTCTGTGCGACTTCCGCACANNNNNNNNNNGTTCAT
CGAGTTGTTTTCAGGGTTCCGCTCGCTTGTTGGCGCGGATGTGGTGACTGCATCGAGGAAGTTCCCGCATGCGTACTGCGATTCACTGGTGAATGCGCTG
ATGGGAGAAGTGCTGCGCAAGAATGGCGATACCATGANNNNNNNNNNNNNNNNNNNNNCCCACGGGCAGTTTCTTTGATGCTGCAAATGGCGACGCTCCG
GACGGCAAAGCGCGACACGAAGGAGTGCAAGTTGGCAGGACGTTGGTATTTTGCAAGACCGAGACGTTCAATCAGTTCTCTCAGCTTCGTCTCGAGTTGC
GCGAGCGATCAGCACTGGTGCTGCAACGATACTACCGTGGATACCGCCGCCGCTGCTTCTTCCAGNNNNNNNNNNCGAGTTTGTGCACCGGATTCAGTCG
ATCGTGCGAGGCTTCATCGCCCGCAAGCAAGTGCGCGAGATGAAGCGTGTGCGCCAGGAACGAGCAGTGAGCGTGATCCAGCGAAGCTGGAGAAAGAAAC
TGGTGCGCATGCATGCAGTTGACAAGAAGATCCACCAATTCCGTGTGCGCGTTGCGTTCAGACGCTTCCGACTGGCGCATATTCTCGTCAAGGAGATCAT
TCGTGAAGAACAGGAGTTGCAGGCTGCTG