Description :
From Genome Similarity Track
Location :
contig_34:198080- 202145
Transcript NameFunction/comments
g7792.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g7793.t1hypothetical protein

Sequence
4065 bases(100 bases per row)
GTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATATCACTCGGCTTGGCGGTACTGCTCGTACGACCA
ACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGACCCGCGAGGAACACT
CCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCGTCATGAACGCTTGACC
TTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACAGCGAG
TCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAA
CCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGCCGACGAAGAAA
GAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCC
TCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCACTTCCCCAC
TCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCGGGCGGTCGT
GGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTGGTCGCTTGATGGCA
AAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACTTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTAC
CGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAA
CAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACC
GGTATCCCGCAGCTGCCCGAGGCGCCTTCTTGACAACACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCGGGCG
GTCGTGGTCGGGGTGGCGTCCATGGTGAAGGCGTAGTCGGGGTCTTGGTCTTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTGGTCGCT
TGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGA
TTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCGTA
GCGTAAACAGCGATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCGTCACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTAC
CGGTATACGGCAGCTGCCCGAGGCGTCTTCTTGACAACACGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGT
CGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTC
AGCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGGACG
AGGACGTGGCGATCTGCCTGTTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAGCTGCGATCGCAAGACGT
CGTGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAG
TCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCGACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATG
GCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAGCTACGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTC
ACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCC
CATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGGACCATCGTGGAACGAGTGGTTCTGCCCA
ACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTT
CCAAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGGCTCCAG
ACGCCTCAGCGATCGGCGAATGCGGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGGTCG
ACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGCCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCC
AAGCAACCGTGACAAGCGTCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCACTGGGTGGCAGCAAGTATCTG
CTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGC
AGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGA
GCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCC
AAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGA
TCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAA
GGCTCGCGCCGGGTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACT
TCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACAACGATGG
ACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCT
GGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAACCCGACGAAGAAGA