Description :
From Genome Similarity Track
Location :
Scaffold_4:198073- 209825
Transcript NameFunction/comments
Phyca_LT1534503525endo1 putative
Phyca_LT1534100525Hypothetical protein
Phyca_LT1534503527Hypothetical protein

Sequence
11752 bases(100 bases per row)
tcacccacagaaatgcgacaatcggatgcacttactaaaatccagtcattgttatccggatgcactctacacgtagtcaatgttatccggacgctactca
aactcagaaaaatcttccattatcggatccgccacgtaccctcgagtcttcagtaacaacaggatatttccttcggcatgtcgtattcactattcccacc
tgcagcccccaatgctccaccagcatctgcttctcccccaccgccggttttccggtcaacgggtgacctgcagaggctcatttcgccccatttcctatct
ccagaggcgcagcagcgacctattccgaccaacgagtggtgggggaacttgctggcatgggatggacagaaagacagtgacgctgtgtttgccggccctt
atacgtacaaggtggtacccagccaacccggatccatcggcagtggtctatcagttagctacttgacgcagtaccggtcggacggtcccatcaatgacaa
cggagctccacgcttctacttctacccaccgacgattaagaactggatcttctcggctgtggaacttgcagctcaatccggtccaccgccgcttagtatc
cattcttgggatgacatgggagtgcatttgtccatgactgggatgagaatgtacctggcattaggttcagctttcacgacagtggaataccaggacatgc
aagtgcaactaagtacggagcattgcattgtggctatcaatggagctcctgcgagagatggtcaccaagtgaatggcatcagctttgtgatttctttgaa
caacggacagctgtgggtgctctacttcttctccaacgctggtggcaacacctcattggtgttccaggacaacaagctcacgactacttcaaagttcacg
ggtgttgttcaagcagcttttgtttcgtccagtgcaatgcagtcttcggtgcctcaggacgatcacaagatcctgcaactttaccatgcaagtgctggcg
tttatccgaggggggcttctgttcagacgctggactccgagtcatttgttttcaattggcaacttgtgagtgcacccggaagtaaccccggagcccgttt
cctgcacttcgcactgactcatctgcaaggaatgctggatccctccacagttgagccaaagcacgagctcatgttgagctcgcacacgcatggaccgctg
tttgcgtacatgttgaaaactccacccaatgccaatccaacatggttgtgccgtgtgcctcaaacagaaagtcatggggtggaaatgtgtactgcatttt
acccacctcgtgctggaaccctcacgagagatgtggttgacagactcaatttgtgtcaagttgtcgccgatgaaatttacggggactggtctcttccgca
tgaagggagctactactttaagggcaaggcgctacagaagtttggtacgatgtgtcttgtggctcgtcaacttgcagataccaccaatccggagatgcgg
gatgtggcgcagcacggcaccaacaaattgcagcagttgatgtcgcaatttgcggacaaccagtcggcattccctcttgtctacgatactgtgtacaagg
gaatcatctcaagcgaggcgctggctcggaacgacatgaacgtggactttggtaatggcgtgtacaatgaccaccactaccactatggctacattgtaat
ggcggctgcgatcgcgttgtacttggatccgaattggcgccattctgcagatgccgtaaagcttcgaaccctggtggatactcttatccgggatgtggca
acatcgtcccccatcggcagcgacccttactttccacgcttccgctactacaactggtggttgggccattcgtactcacacggagtgaccccgatggctg
atgggaaggacgaggagtctacgtcagaagaagtcaactttctttacggcattgcgatgtatggccaggtgacggagaatgcagagcagcaggctttggc
aaaactcatgctcaaggtgtacgtacgtgctgtcaacacgtatttcttgctgcgtaatgacggtcctgctatccatcctgccaacttcgctaagaacaag
gttacgggcgtcttcttcgacaacaagtgtgactacacgacctggtttagccccaacaaggaatgcatccatggtatccaaatgatcccagtatctccaa
ttcttgaagtctcccgaccgccacactttgttcgcgaggaatgggatgaagtgctgagccgccttccgatcgtaaatgactggagagcgaatcagtctgg
ctggacgtctctgctgtttgccaactacagtgttcttgacgtgaaaaggcgttcgaagtactctctacgtgtccaatggacgacggactcagtcgcgcat
gggcgctgtactacgccgctactcgaccgccaccctcgtgctaaacgaaaagttttaacatgtagtggcttcgtattgcaagagcgtctgaattgccttc
aaaaacgtcgagctgtatttcgctgtatttcgttgtatttcttccagttttcacggagtcattgcttgtaggagtgactgtgccagttcgcttacaacag
gtgacacttgtcgatcgcgcactacgattaaacacctggaacaatgttgtcaaagcactgcaagttcgagcaagttaagattttatcgcacctgtcgatg
aggtttagcagttccgtttgcggcaaagcttcaatgaatcccggtatttttccaatgatagccccaatgacttttagtccattcatggcaacagattcgc
ttcgtgtggccgaaacatgagtagtcgtagtctcaaagcagatccgaacgagttgggcatcgtcattatttctcatcgagatcaactcatcattagcttt
gcacaagaacaagaaaataatctgtaacaacagtgaacaactgtcagcccactagcaagacaagcctgagtaaaatcgtagtacctggagtcctccggcg
ataacgtcttgattagaacatttctcagtagctaacgcaatccgtgagatgaccccctgtcttttccattttataagaacactgttctccgatcgcgaga
tggcactacaacagacagtcagttagtgggaacctggaaaagaatggatccatttgttgcactactcacttcagaagaatattgcaacagcaaacgcgaa
cttgcaatggcaactggccgtaaccagcttcactccacatcccttcgagcagctcctgtacccgcgaggcaatggcagcagcacattcctcattgatatt
tttgcttttgactccaaatatccaggcaattaaaaggttcatcaatgacgcagcatctccaggcttcttcacgttatcttgtgcgctattacactctgca
agcctggtgagaattattgcaatgcaatctatgcagccacgttggaggtcggtgagaagagcttcatcagagttttgaacggacggaattcccaacactt
gtaccaacaggacaagcgcttttgacgtaatgtcacaatcttggaaggcatgatcatcttccgaaaagatccggttaaggtaatatatcatcagctttgc
cgtcaccaagccacaggaatccggaactctatcatcttcgactatagatgaactatctcgtttgtcgtgtgggatagcttcgcgcaagaaagcaaccaaa
tatccaaacacgagcggcagcacgaggaccggacggaatttcgctagacattctgtagccagcatcttgacctccttgaattccaacggatcaactactg
agcgagttagtagatggaataaaatctcgtctgctgtatccgtctcaacaacagagctggcttccagagagctgctgtagagtagttgctgacggtcgag
atatgcattcaaatgattcaaatcctcacacccacactgtcacaatcacaatgagatgtaagggataacacgcgacagaaaataatgagctaccgccgac
aggtctacacgtaccggaaatgtctgggtctgattgattccaaatacgttgcgggggaacatccgaagcaccaataacggagctaaacgagcaaatagca
gctcttcaatccttttagcagctgaaggtgagttgtcgtctaagatgtcttcacttaaccgaggtacagtctgtaatagccaacacgatacttagaatta
ttgccaatgtccagacatgaacaacccttaccatcatatgcgtgcaaatttgtttctcaaaagtttggaaaacctcgtggtttatccagccacacgccac
aacttcacgcagcattcgcagaagtgctgggtctcgaggcgaaccaaatactttgcaaagaagaacacgaagaatttcgcttctactttcgcttctactt
gtaccttgaatatgcttactccacctgtacgtagattgaatcaacattattaggatagaaacctccattgcacggtgttgtgacgtacccaattggtccg
aagcaaaacgccagcaatctttcttggagttgtttctgtttctcgcccaatgcaatgatttcactacgacttgtggccagttcactccattcccgagggg
attcaggaatcttgctcggcaccgaatgaactaggacacttccaaactggacagcatcaacaacccaagacgccatcacttcacgagaacttttgcttga
agtcacaaaaagatgcccgatcgccgatgtaaaaacgtggttgtcgggcgcatcaaggccaactgcggtcaatagagccatgcagagctcaggatccagt
gaaggcaagcacgatagagcctagagaaacatattaggcaaatatattcgttagaaacccaagttgttgtatgcaggtatcgaagactgacctgtcgacg
aaagttctgattgtcgtgggtaatgtggcctaatactgccggtgcaagctgcttgctgctctcaattaaaagttcagtgacttcagtatcatccgtcaat
gcacaagcaatgtgtggccttaccgccaatgtcggaatagctgtgattgtgttggcgaactgtcgacttgatagagaaatgtccgaacgagagaaatgga
aggctgctagcatttcagcaacgtataagatcatacaacttccacacatcaggaatgcttaacttaccaagacgcgctgagtgcgcactcgctgtacaag
ctctgtgatgaataggcctcgagatataatgaagtcggctatgaacatctccatttctgtttgagcttgtaacatgctatcagaactgtcacgagtccag
acgttgctgtgtgaatggatcaactgtgaaaggagttcttgctcttcttcttttgagttcaagaggtgaaatgcatcgtcaggtatcaaaagagctctta
acactagcaaagcaaggaggatggacgtgccgtttccctcatcggatgctgtagacaaaccctttgcaaacaggaaaacaaaagacgccttggtttccac
atcaaagctaccaaacgccttggaacaaccattcaatccacccatcgaatccatcagtacgcatacatagcgcagctgagcgtaaatcatctcggaatca
aaactgcaacggttcaacttggagttctctttcgtgctgagcaaattatacgtccacttcgtcacaacttgagcaagaatttcagttgactgtttttgaa
ttcgagaaaacgcgtcgctacggctgcaaaacatggaggcggtcacctcccattgccagcacaacacatccaacgctactggtacacttatatccaagtc
acgagcagtgttatcaccatccaaactggacaaaagactgtcgcaagtttcaacatacgtctgcagattttgcagggcgtatccaagaaactgtcgacgt
tttgaatgcaaatgccactgccgcagcgacaccagaaagaatcgcattctacccatcacttcacgcatgaagccattttcagccagatccctcttctctg
cttcactcgaggtcatatactgcacgccaacgtcaccacacaataacgcaagggtttccaaagcaatcagggcaagtttcgacggcttggcacgattcga
ttcagcaactcgaactattcctctttctgcaacacattgtattgcatccatgaacactccagctcgatcgccaaataagcacaacttctctttaccacac
acagaaatattcttcttcaacgtgcggcgacgtcgctgcagtaactcgaaaatcgttagacaggcagccaactggttctgtttctcggccgtcggatgaa
tccactcgagcagcaattgttgcacgttgtaagtagatccgcactcatgactcatcatccagcccaatagaacgtgcagcttctctgcctgtggacccca
aatgcaacaattggtccgagacgaggtgcaatctttcatagataatttcatggccgatccagccactgtgcacactaaattccgctttgaatctatgtct
tcagcttcttttcctcctccactcttaacgtcgtaagcattgacgacggtagccaaagccgcttgcagtcgcgcaattcgtttgtggtcagacaatgaaa
gcactcgaccctgtgcagcgaaagtgttaacaagttgcagcagaacatagtactgaatagaagtaaatagtgaatacatcatcgaagtgattcagctcgc
ctgcagcctcgtcggaaggtttaaccaaagactccgatctgactccatttttgacacggtctagacttgctattgccgcctccatctacgtaaccacagc
gcgtcaagaggtcacagttatgtcattatgtgggacaagcaataaggaagaagattaacgttacgtggaagagctggcagtcctccaggacgcgtagcag
ccgccccgcgctgtccctatctcttgcccgcgccatttcaaatgcgataaatatcacaaaaattgaatggtgtgtgatacaccattctcttcttttcatc
agtttttctttctcaaaaattaatctttcttcttgataagtaccaactccattatacatacagatattcctagagctggtggcttcctacctctcggaag
catgtagttttgctacgaccttacagcgtcaacgtgttagggtggtcgtggtcgtggcggactttatccacatcgtagtacgacgagctgtcgtcggaat
gagcgctcaggaacgattgattcgacgactggttcgaggagcccgtgcctcgtcggtgcgtaggatagtatctgccgtcgtcgctgctgttgtcggtcat
ttggctctgcgcattgaaatccacgcgagacgttgcaaaatgagccgccgactggtatccgtacgagtccatggagtcgcgattgaaggcggatttggta
acaccaaagggtccgagttcatagctctggctttccacatcattgtggtcactactgtccgtactgaccacagtcttcgatcgtttcttgaaccaaccgc
tactgtcaccatcgaagctgttctccgaatcgttcgagaagatggacatcttcgcctgagggctgctaccgtagccaccagtgttcgttttcggagcagc
catagcagctgagaacgtgttgtcctgctgtacagtattctgcgtcatagccatttgactgctcgctgaggataccaccgagtccgagaagttcacgtac
gattgctccatcatagcgtacgaactagccgacgacgcaaccgggttaaagtggtgaccgacagtcgatgcaccagggttaaacggctgatgagttgtcg
aaggtggagcaggctcagcagcaaagtcatcgatatccacatcgtcaatgtccacatctgtacgcatagcatccatatcgaaactgcgtttcctctggga
agacgtggtactagcgccggagtttgcaccggagaagctcccagcatacgcgtcgagcggcaccgtcgatggacgcgagcccagccccgatcctgacata
cctgcaatagcagctccccctctcgaagaaggcggacctcttgacgatgccagacctctagtagagttctgtcctcgagatgaattttgtcctcgagatg
aatgttgtccccgagatgaattttgtccccgagtagaattctgccccctcgacgaaagctggcctctcgatgattggcctcttccggacttgggtgacgt
ggagtatccagcctcatcggtggttttgttcgtaccgaggtaggcagccagtacatcgtacgtcgggatttcttgcgctggttcaggggcaggagcagga
gccggtgctgcgttattcacttcaaaggcaactgcatctcgagaagaccctccaaaggaatactgctgattacgagacacgggtggccggatcttgcctc
gagagcggctaaagactggaacaggttctggggcaggttcgagcatgggcacattctcggattgaccactgcgggagctctgggtactgtagccggatac
agcgctagtctgagactggtattgttgctgaggctggtggtcgtactgttgctcctgaagctgcttgttggcgtaccagtctaccccacggcctgcaggc
gtcgtctctacctgctcgtaagcttggcggttggtggacatgtcgtttccggactcaagattaatatccgtcgcatccagacgggtgttatccttgccat
ttttcttgtgtctgcaaacgatgaccatcttgtggatgatagtgaaagcctgacgcacgaacagtatgaagaagatgaagatattcacgccaatgatgcc
gtaggccacgttgtcgcgaacgttctgcgggaagtaatcgtctctcgccacgatgagcatgaggcagatgaggaccaccttcatgaacaccgaaatgata
ccgaggtagtacaggaaccgcaataagttcggctggcgaatcagcagtaagatcaagtaaaccatcgtgatagccaggatacagagcaactgggtcgtgg
catctctcacaacaccaacaatggcaccagtcatgacggccagcaagatccgaggcacgaagaagaagcgattgtcgaagttgtactcgtcgtaataggc
actgtacttgctgctgaacggacgctggtcatgctcgtaggttccgacgtcctttagttcgtcagtgttgttaccgacaacgataatgccaagtccaaga
gccaggagtacaacagctgcaagagctacaattcccaatgcgtaacgtgagctggagccattagccgaatcattagacgatcctttcgaggcgaagaaac
tgccagccatagcgaacatgtactgcgccaacagtagagccaataccccagcccagataaccttgcgataccatttgcgagcaacgtccccaaacgattc
gttcttggctagagaacccatgatcaggacaaccaagaggtacaacacatgaagcgctgcaatcacaataacgaacgtcacgagagtgtagaagaataga
tcatctgcatccacaccgatgagagcagcatatcttgctggtccggactgtccagctgcagccacaacccccgtcgcactagcactggagtctgccagtc
ttcggtcatctccgctcccaccggagtcgtcgctggtgctcttgaccaggttgaaattcgtccatgagagctctttggagaattgcagtagaaatgtcgg
agcgccttcaattctcaactggctgatcatgccagcaaactgggcctgttccacaatgtgggtcatctcgtagaatccagcagagaaactgagtgctgcg
gcagcactgggcaccacagaagcccacagcatggagcctcctccgatcacggctgcacccgccaaggacgtggcaatgactcctgacgcggtgcttccgg
ccttggagtccaggaagtgcagtgtacctgtagtgttggtgggccattgcgtattgctgccgaagacgcagccggagcaactgttgctctcaatgaagct
ggtgtttagactgccaatgtccacatcggaggcaagtcccagcgtctgacggatctgatcctcgccccatgggatcgcgtacgtgtagaaaatcaggcct
agagcggctagaataccaagaggcagcagcaatgcacagagctgcgagagcgccatgcatccgcagcacttggcagcgcagcacagcagccccatgcttc
gagttaacggtcaggcgtacgaggcgaaggcagagctcgtggtggtggacgtgctgaagcggaactggctttgattcgcgtaggctttgacccgcttgga
agacgatgcagaggcggcggacatagaaaacagagggaaaagcaccatcgagctttggatgggaatgtggcaaaagaccgaaccaagttcagcagctttg
attgggtaaaataaaggatctgtatcggttttcagaggcttacgagttttggccaatcagaagatgagaaaaatagtcagaagttttttcggtgtcgcct
tcgatttgggtgtgagacgggcttggcacgcttttaacagggtctccacagaaaatgcattacgaatgtttgttaccaaaggaagttgtgtgaatgactg
cacatccacttctacttcgcaccaacgttaccgtagtcaaggtttggtcagtccacggcaaaatactctaagcttagtatgagttcgtgctgcagtgcgc
ttatcgattcctttcacttcaccatgcaactctggttttgagttgtacatgtatccataaaatatgtccgcgctactacattttttgccgcactttaccg
gtacgtttgctggcagaaccacgatatcaggagcagattttttttaatactgtagttacctattcgtcgccaatggtcaaacatcttggcctcttcacca
ttatacattttatataatataaaggtgaagtggcctattgttaataattttaacgagagtaatgcaaatactaaagatcatcatcaaaatattctgcaaa
agctgtttgaagaagacctcagagcaagcatcgcctttgcttcttactacatcacgacgaaagtttaagcattaccaaaaaaaaatttaggtttacgctg
ttggtaacgaacgttcaactcgcagcgtgccagtcaaagaagctgaagcgccttttgtagcattattcagaaattgtcgggtttcatcagaaattctgat
tctaatttagagtttatctcgtatacacaaatacgtatacagagattgttttttgtgtggtcacacattgacttttataaaaaaaaaatctgtaacacca
ccatgaccagctcaacccacccatacgaatggtacgcgttcaccgccactaggacaccaacttaaactatacgttgttcacattatactcacatatgccg
ctctacttgtagcgaggtcagcttgcacttccctgaagaagtggatgcacagtttgtgctgcagacgcttgaggttgacgaggagctgcagcctgagaaa
atccaccgcacactcaccgtgaagggcacagagctccttgtgtacgtagtagatctattttagatcttgtatgtctctattggcatttacgattttggtt
tctgctgtactggatggttgtagccacttcgaggccacggagattcgactgttgcgcgctgcagtgtcttctttctacgacatgagtgtgctgacagcca
ggacgctgttggaattcaaggagtgaacgaattcacgaatatacatgcttct