Description :
From Genome Similarity Track
Location :
contig_8:198055- 199056
Transcript NameFunction/comments
g1579.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
GAGAGTCCACAAAGTGCTGAGGTGTTTCACACGCTCAAGGCTGCAACTCTGCACAACCTGGCAATTGAGTGGGCCAATTTAAATATGCCCGACCAAACTC
GCGATGCACTAGCGAGCGCTATGGAGGTTGGAGTTCACTACCTTCCCCAAACGCACCCCGTGGTCGTGCGTATACTAGAAACCTACAAGGTTATGCGAGA
AAATTTCCTGTTCCACAGCAGCAGAAGTGCTACAGCATCAGTTGGGGATCCCCCACAGAGCGCTGCTCGACCAAGTGCTCCTGTTCGTCCTACCTCGCCA
CCGCCTCTCGAAAATGGTACCAAGCGACCCTTACCACCCAGAGCACAGAAGGCTTCACACGAATCACCAGGTGACCTGACTAGCCCTCGAACCAGACGAC
TATCGTCTCGTGCAGCATATCATCCGGAATCCGAAGATATTAGCCCTGTGCCTTCGGCTCGGCGACCTACAAGTCCGACGACAACATCTGTAGTATCGCC
ACGCGCGCGGGCCGCCAAGAGACCAACCACAACGCCAGCAGTGCCAGCAGGGTTTTCAGGGCAGACCCTGCCGCTTGGAGCCACGCGCACGTCACATCTT
TGGGCAGTACCAGACAGGATTTATGGCCATTCGTTGGGGCGAAATACAACCCCCACAAAGAGCGCGTTCTTGAAGAAGCTCGGACATTTGTATTCGACGA
CGAGCAGCAATCCGAATACAGGTACGTTAAAGAGAGCAAGGTAGAGGGCCCGGGAGATGCTATCGACAAAGCTAACGCTTCTCTTGTTATAATAGAAATC
ATGGCGGAGTGCTCTTCAGCGGCATCGCGCCGTAAAACGAAAGGAAAAGGCCTCCACCCTGATCCAGAGTACTCTACGCATGTACTATCAGAAGACCCGG
TATGAGCAAACACTTCACAAGATACGACGGGTGCAAGCTGTATGGCGTGGTGGCGTGTCACGGACGCGTAGGACAGCGACCCTGGCATCGATAGTGCAGA
T