Description :
From Genome Similarity Track
Location :
Scaffold_8:198054- 212083
Transcript NameFunction/comments
Phyci_90128Hypothetical protein
Phyci_211569Hypothetical protein
Phyci_2304Hypothetical protein
Phyci_90132Hypothetical protein
Phyci_266514Hypothetical protein

Sequence
14029 bases(100 bases per row)
GCACATCCGCTGAGATCTTAAGGAGAAGCAAGGACACCAGCTGATGGAGCGCTCGCCGCCGGCTGGCCCACCATTGCACGCGTCACGAACGTTGCCGCGC
AGTCCATGCAGCGCGGTGACAGATGGGGGGCCCACCTTGAACCAAGACATGTGGCGCCCAGAGCTGTCGAAAGCTCGCGCGAGCATACGCGATGAACTGC
CGCCTCACTCTCAACTCGGCGAGGCAGGGCAGAGGTCTTAGCTCCTCAGGCGGAAGACGTCACCGACCACCACCACAAAGAGACGCCGGACAGAGTGCCA
CGATGACTCGGCACGACGCCAACTCGTTCTCGGACTCGCAGTCCTCCGGCCGGTGCGTGGTTTTAAGCTATTTGTTGCGCTCGATTCGCTCCCTGACCTT
CACTTCTTGCCGCTTTGCAGGGACTCCGGCGACGTCATGCACGACAACGGCGGCCAGTTCCCACTGCCCGACGGCTACTTCCCCGAGCTCCGCCTGACAG
CGACTGAGATCAAGAACTACGAGGCGCAAATGCAGGAGATCGTCAAGAACGCATTGGCAGAGTATGAGCTTCACGAGGCCAAGGGCGTGTACCCGGTCTA
CCGAGCCTCGTGGAGTGTCGTCGGCAAGGTGGAAGGGCTCACCACCATCAAGAAGGAGACCCCCGACAACCCCACCACCAGCCAGGCCCGCATTTTCGGC
CGCATTAACGGCGACTACCGCCACTTCATCGACTTCTTCTACGCCGAGACATCGGCCGATCTCTTCGCCTGGAATCAATTTATGTTCGGCTACGCCACGG
ACGCAGCGGTGCTCAAGAACATCCACACGGTGGCGTCCAAGAAGAAGTGCCTGTACATGGGCATCAAGTGGACGTGTTTGAACCCGTCGTCGCTGGTCAA
GAAGCGCGACAACTGCTACATGGAATACCTTGTCTACACGAAGGATCTGCGCGGGCGAGACGTAGGGGTCCGTGTCACGCTGCCGCTCGACATCCCGGAG
TGCCCCGAGCTGCCCAAGAAGCTCAAGACGAAGCGCATCCGACTCAACACCGTCTGGATTTCGCGACCGGCGGACCGCGAGCCCAACGTGACCGAGTTCT
TCATGCTGTCCCAGAACAACTTCAACGGGCTGGCGGTCACCGCCAACTACTACAAACGCATGATGAACATCCTCATGAACATGGCTGTTTTCGTGGATTC
GCGCCGCATTCTCATGCAGGGCGTGGTCGCCAAGAAGAGTTGGGCCAAGTCGGGCTCGCGCAAGAGCTGCAGTGTCTGCTCCCGCAAGTTCGGACCCACA
CGTAGGCGCCACCACTGCCGCCTGTGCGGAGACCTTATCTGCCGGCGGTGCGCTATCGTGCGGGATGCCCCTAAGGAGGACGATGGAGACGGCGCAGGCT
CAAACCGGACGTTCGAGATCGTCAAAACGAAGTTCTGCGTCCTGTGCGTTACGAAGATGCGAGCGTCGCGCAGCAACGTGCTCGTTCCGGTTCCGGCGCC
GAGCGGCAAACTTTCGGTCGTCGACTGCGTGGACGTGGACCTCGACGAGTTCCGTCAATCGACCATCTCGGAGACCGAATCTGAGGGAGGACACATTTCC
TTCTTCTCCGACAGGGGAGGCAGCGAGGGGCGGTCACTGCAGCTCTCGCCGCAGTCCACTTCAACGTCGTCGATGTCCTCCAGTCTGGGTAAGGTGTCGT
TCGTGTCCAAGTTGGACGTGATTGATGACGAGGCGGTTACAATTCTGGCGGTCCCGAGAATGACCACGAACGAGCTCATTGAGGAGGAAGTCGCGGAGGT
TATCGACACTACAGACATGGTTCCGGTGTCGCTGCTCGGGTCTTCGGCCAAGTACAATGCTACACATGCTAGCTCCCCCAGCAAGGACGCGGACTACGGC
AAGACGAGCTCGGGCAGCGGCACCGGGTGGTCTCCGCTAGGCTCGAAGACCTCACCTCGGTCCCTCGACCAGTGTCTCGCCGAGCAGGAGGAGTTGCTGC
GACGCATGATGCTTTCGGCCAGCGGCGGCATGCAACACCAGAACAGCTCGAACCCAGGAAGCGGGAGCTTGGGTAGCAGCGGGTGCAATCCCGGCGGCGT
GCAATCGACGAGGTCTCGCCCCGAAGTTACGCTTTACGAGGGCTAGATACAGTAGTCCTGTCTGCGAGGCATTACAATATTACCCTAAGTATGAAAATCG
TTTGCTAACCGTGATGCTGGTCCCACTCCCACTTCACACATCGGCCCTGGTGCTCAAGGTCGGGGTCGAGATTGGAGCCATTACGACCACGTCGCGGTCT
CGCAGACAGGATCATGGCGAGCACGAAGTTGAGTTCACCACCCTTCTATCCTTCCAGCCTCGCAAAGCTCCAACGCGACCCTGACAAGTTTGAGTCGTTC
AGCGTCATGGTATCCTAGCCTTCCAACGCGTGGCGAGTCCATTCGTTCAACGGCTTTTCCTGGCGTAGTCGCGTTGCAATAGTTTCTCAGCCCACGCATC
CTCAACTTTTTTAAACGATCGAAAGCAAGCTCCTCCAGACTGGAGTCCAGTGGCTTGTGGTGCCGCGACAAAGAAGCCATTGTGCACGGCAGGAAGCGGG
TCGGAAACTGCAGCCGAGGCACGCGATCCGATCCACACAAACGATGAACCGGCTTCCGTGATTCGGGTTGTCAGCATCTGAGATGCGCGAACGGATCGAG
ACTTCACAATCCTTCAATTGCACGAGCAATGCCTCCGTCAAACAGCATAACCGCCCTCATTCCTGAGCGCCACATCGGACGCGTGCCATACAAAGCACTG
CGACTGAGCTTTTGCTGATGCACTCCACAACGGAATATTCGAGCGTCATCGCGAAAAAATCAAGCCGCTGCGCTGAGCGTGAGTGCCTCGGCTTCGCAAG
CTGCTTCATGGGGTCCATTCGTCCTGCCGTCAGCACTTCCAGACTTGCTTGCCAGCGTTACACTTGCCCCCGTGTTGGTTCGTGTCGTTCAGTCGGTCCG
CCGCCTTATCAAGAGTTGACTTAGACCTGCGCGATCGAACAACACGGCTGCAAGGATCTCGCTGTTGCTCGAGCGCGCTCATCGTTACTCTTCAATCGAC
ACCATGCCGCGCAGGACGTCGCCCTCGGTGCCGCGCACGGCCTCGGTCACCTCGACCACATCAACGTAAGTGCACAGTGTTCGTCAATAGGCATCTATCT
GCCTGCACCAGCTGAAGCAGCTTTCTGAAGTTTGTAACGGCCGAACAGTTGGGGATACCCTGGTTCATTTCGATGCTCGTCTCGCGTAGCTCCCCAACAC
TAACGATCGTCTTTGACTCGAATGCAGATACCGGCCTGGCAAGCTCCAGTTCCCTCTGCCAGATGACTACTTCCCTCCGGTGAGTCTCTCGCTGACGGAG
GTGCAGCAGTACGAGGAGCAAGTGGAGAAAATGGTGACCAAGGCGATGGCATCCTGCCTGGACCACGAGGCACGCGTCGCCGGCTTTGGGCTGGAAGACG
AGAGGCGCTGGCAGGAAATCGCGCGCGATGAGGACCTGTCGATCGTGCGCCGCAAGCAGGGCTCCAATATCATCACGCGCACCTTTGGAACCGTCACGGG
CGACTTTCGTCGGTTTGTGGACTTCTTCTCGTCGGACACGTCCGAGCAGCTATTCGCGTGGAACCAGTTCTTCTTCGGCTGCGCTGTTGATGCCGTCGTG
CTGTGCAAGCTGGACTTGGACAAGTCAGAGAAGCAGGCGTCTCTAGGTATCAAGTGGACCTGCATGCAGCCTTCCGTGCTCACGCGTAAGCGTGACGAGT
GCTTCCTTGAATACATCATCTTCAAGAAAGACGATCAGGGTCGCGACGCTGCGGTGATCGTGCGCAAGCCCGTAGATATCCCAGAGTGCCCGCCCCTGCC
GCACGAGTTGAAGACGAAGCGCGAAAAGGTCACGACCGTCATGGTTGTGCGCGCGTCCGACATGCACCCGAACGCCACGCAGCTTTTCATGGTCACCGAG
TGTGAAAACAAGGGCCTCACCGCTTCAACCAAATACTGCAAGAAGCTGCTCAAGGCTCTGAAGGATGTGTCTCTTTCAGCTGACGCCAAGCGTATCTCCA
CCACTATCAGCACGCCTGGCTTCGTGGAGCAGTCACGGAGGGGAGAGCCACAGGTTTTCGGCGACAACATTAAACCGTGGGTGCCCACGGGCATTCGCAA
TAGCTGTACCAGTTGCACACGGCCGTTCCGTGCTGGTCACCGACGTCGCCACTGTCAGCTCTGCGGCGACGTCTTCTGCAGCAAGTGCCTTGTTCGACGC
GCCGGCATTCGACAGGAGAAGAACGCCATCACTAATTACATCGCAATGGCCAGCCAACGAACATTCCGTGTGGCACAGGCGTTGTATTGCAAGGTGTGTG
TTACCCGTTCCCGTGAGGAGGACGCGGAGGCTCTGCAAGAACAGACCGAGGGAGCTCGTCGATCACTGGCGTCTTCCAAGTCATCATCGGTGCCACACCG
CTCGTCGATGGGCTCGTCCACACAACCGCGAAACTCTCGTTGCTCAACTCCGACATCGTCGGCGCAGCGCAACTCTCTAGCTCAGCAACCCGACGTGGCT
CGACGCAACGCCACCTGGATCGAGGAGAACCGCTCATCGTGGTGGTCTGAGAACGATTCCGAAACGGGGAGCTGGAAGTCAGGCTCCGGCCGTTTCAGCA
ACATCTCGCGCAACTACAGCGGCGCCCCCACCGTGCGCTCGTCGCTCAGCTCGGACTACTCACATGGCAGGAACTCCTTCATGGCGGTGCAGTCGCTCCA
AACTCCGCGTGAGGTTGATAATGAACAGGGTGACGACCGCATTGACGAGCGCCGATCCAGCATATACGAGGTGATCGACACGAAGGATATGTTGTCCGAG
TCGGAGCTCCGGCGAAGGAAGCACTCCTCGGTCTCCGCCTCGTCGGACGACATGTCCGACGAGGACTTCTTCAACGAGCTCACCGACTCCGCTCGAGCTC
GATACACGTCGACACCCATCGCACCGACCTATCTGCCGCCGCGCTCGACCAGCCGACGCACGCGCAGCACCGACCAGGGCGAGAACACCAGCTCGGCGAG
ATCGCTGGACCAGTGCATCGCCGAGCAGAATGAGCTCCTGCAGCAGGTGCTCACGGCTAGTCGCGCTTACAACGCGGACCCGCACGCGCGTGCTCAGGCC
TCGTCCTTCAACAGCACCAGCAGCATCAGCGAAGACGACGACGACGATAGCCACGACGATGGCGTTTATGAGCTGTAACACACTTAGCCACCGTGCATAT
GAAGCAAATACCTAGAGGCATTCATCGCGAAAGCAGCGACGCCATAGTAAACCACTCGCCCCATCGCAGCCGAGTACACAAATTATATCCATAGACTTTT
GATGCAAGTCTTCACCCGCCAAGGTCGGCATCCATTGATGTCATGTAAATTACATGTACAGACCCAGCAACAGCTGCTTGGTAGAGCTCCGTGTCCTCGT
ACTGTGGCATCTAACGCGCAGCACCTTCCGTCAACTCGTGTGGCGCCGTCCATCAACACGTGTGGCCGTATTCATAGCACTTCAAGAATTATAGCGACAT
CCGAGAGCACACATGGCCACCATGTGGCCCGCCACGAACTGCGTCTTCTCCCGGCCCGGGTAGGCAATACATGTAACATTCGTAATGGTAACCACGCAGC
AAACGATGTCACCAAGGTGAAGTGCCCGTTCAAGTACTGTAGTCGCTGGAAGAAACGCTGGAACTCGAGTCAAGAGTGTGGTTCGCCAACTGAAGTTGAG
TGCTCTTTTGCCGGGTGGAGCATTTCGATGAGGCATGGGCGTTCGTGGCGAGGTTGATTGCTTCTCGCTGGGCACATCCTCCAGCAGCCGAGGCATCAAA
CCATCCAGGAACGTGGCAGCCAGCTGTCTTATTCGCATCACCACCTGCGTGCAAGCGCCCAACCACCACCGCTACACGCGAGAGGCTGGGCAGCACACGC
GCATTACGTGACTTGCGCGACCGCTGCAATGTCCTCTACAAGCTCGGATCAGGCGTAAGTCTCCCCGCTTCCACTGGATTGGCACCAACGCCAACAAAAT
ACTGACCCGTTGTTGCTGATACCAGGCCCGACACGTTTGCTGCGCGGGCCAGCAAGGTGAACACGTTCCCCGTGCCCGACGACTACTTCCCGGATGTCCC
TCTATCGGCGCTTCAGATTCTCGAGCTGGAGGAGAAGATGATGCTGACGGTCAAGAACGCGCTGGCCGAGTACGACATGCACGAGGCCATGGGGCCCAAC
CCGAGCTACGGCAAAGGCTGGAAGACGCTGGGCTCGGTCGCCGACCTCACCACCGTGCGGCAGACCGGAGACGCAGCCAGGTGCCAATGCCGCATCTTCG
GCCGCCTGAACGGCGACTACCGCAACTTCATCAACTTCTTCTACTCGGAAACCTCGAGCCAGCTCTTCGCGTGGAACCAGATCATATACGGCAACGCCGT
GGACGCCGCTGTCCTGAAGAACATCCACACGAGCTCGTCGGGCAAGCCCCACCTGTATCTCGGCATTAAGTGGACGTGTCTGCAGCCGTTCGCGCTTGTC
AAGAAGCGCGACACCTGCTTCCTCGAGTACATGGCTTTCACGAAAGACCTGCGCGGCCGAGACATCGGGGTGCGCGTGAATATGCCGCTGACGCTGCCCG
AGTGCCCACCGCTGCCTGGTAAAATGAAGACCAAGCGGATGCAGATGCTGATCGTGTCCATTGTGCGCCCAACCGAAGGGGATCCGCGCTCGACGGAGCT
GCTCCTCATGAGCCAGAACGACTTCGCCGGATTCGCGGTGCCGGGCTTCTACTTCAAGAGGCTGATGGCCAAACTGAACGACATGGCCGTGTATGTTGAC
GCGAAGCTCATCTTGATCCACGGCATGATGAAGCGTAGCTGCTGGGCGGACAAGAAGGCGAGATCAGAGTGCCGCTTATGCTCACGCGAGTTCTCCACGA
TTCGCCGTCGCCAACACTGTCGGCTGTGCGGTGAGGTCTTTTGTCGACAGTGCTTGGTTCACCGCGGAGCTCGACAGGGCGAGGAAGACGGCGACAACAC
GCAGCGGACTTTTAACGTTGTCAAGACCAAGTTCTGCCGCGTGTGCCTCGCCAAGGTACGGGACTTGGACGTGACGCTACTCGCTCCGGGGAAGCACGAC
AAGCCGGCCACACTGAGCATGTTCGCGGACTCGGGGGCATCGACGAAGCCTGACGGTGAGCACACTTCTCTTGGGTCGTATAATGGTGAAGACCAGCGCG
GCTTACCCCGCTCCTCGTCAGGCTCTGAACTCCTCGAGACGATTCGGTCGTCTGGCGATCGTGATGATGGTTTTGTAGATGACGACGAGCGCAGCGACCT
GGATGGAAGCAGCAGGACTGGGCCTTCGATCGGCGTCGACATGTCCAACCTCATGTCGGCCTCCCAAATGATGCGCCGCATCAATGCAGGAGCTTTCCCC
GATGACAACTCCGCTCACTACCAGCCCACCGCCCCCGGCACAACCAACTCGAGGCGTACCATTAGCCAGTGCATCGCCGAGCAGGAAGAGCTCTTGAAGA
GATTGATGCTCGCTGCTCAAGATAGGGCCCAGCTCTGAGGCAGGGGATGCAGTGAGTGATTCCTCGCCAAGGATTTCCTGCTGCAGTCCGGTTTTGCTGG
GCAACGACTCAAGCTCGAGCACTGAGCACTGTTGTGACACCATTGTTGTCACCATGGTGCGTGGATGCACCTGAATGGGATAGTCGATTGCGTGCCACCA
CCCATGGCGCTTTATGAACGACCAAGAGGGCTTGTTTTTATGGAAGTGACCTCGTTCGTCGTAATACGAGTAACTATGATATTGTTGCAAGCGTTCGCGT
TTGGTGGAGATAGAGATGTCGCCGAAGCGCTCAGCAGTTGCCGTTTGAGTGTCGCTGAAAGCTCCGTCAAAGCCTGTTTTCGTTCCTTTTGCAACCACTG
CGTCCTGGCAATGACGAGCACGATCCTAGAGAGAGTGGGCATTATAGTTTCGCATCCCTGGGGCGGGGCGGAACTCGCGATCGTCGGATCAAGGCTTTCA
GATCGCAGGAGCGATCGAGTTGAAGGAAGTGCGCCGAAGGTGGCTTCACGTTACCCGCTTGGAGTTTTGCTCGAACGGAAAATCATAACTTAGCCAACTC
AAGATGGGTTGCTGGTGGAATCTCTTTTCGTAATGAACTAAGACCACTGAAATATTGATTCTGAAACATGGCAATATACTAACACTACGTAATGCGGTGT
ACGTGAATACGCTGCACTCCCAGGTACAGGTAGTCATCGTCGGTTGTTTTGGTTCGCTTTATGGCTCGAACGATTTCTGGGTGCGGGCGCTGGGCGGGTA
ATATCCAGAAGACGTGTTTGCCGCCATGACTAGACGCTTCAAAAGTACTTCTTGCTCTTGCAGACACTGGTCGATTGACCGACTCGAGCCAAACAGCACC
TGGTCTGCTAGGGATTTTTGATCCATCGGCGATTCACCAAGCGGGGATGACACGATCTGTCGTGTAGTGGAAACAATCTGGTACGGCTCGTCGATCACTT
CAATAACGTCATCGTCGTCGTCGTCTTCATCCATGGGTGGTAATTTGCCGCTCCGGTTGCTTGAAAACCCATCAACGGCTGCATCCTGGTCTGCGTTCGA
TGGCGAGTTCACGAGGCGGACGGTCTTGAAGTCCAAAGCTGCGAGGGATTCACGCATCGTCCGTATTTCTGCTTCTTCGGCTTCTTGTACGACGCGTTCC
GCACCAGCCATAGTTCGGAGGTGGCGCAGATCAATCATCATCGAGGCAGCAGCAGGTTCAGTGACTTCCTCAATCTCAATCTCCTCTTCATCTTGCGAGG
ACGACACGCTCGTTTTCGTCTCAGAGTACACCTCCGAGCCGACGCTGCTCGAAAACTTTTCTTTCTTCGTTTCCTCGGAGTCCGCGACAACAATGTCTTG
CGAAGGGATGGAGATAGCAGAGTTTGCTTCAACAGGCAATAGTGAGACAACCGACGAGCCGCCAGTCATGGTGAAGTTGGTGTCATTACCCCGGCTTCGG
CGTTGAGACCTGTCGGGGAACCAGCTCGTCGACTCGGCGTCTGAAGCGCCCTCGTCCTGGCTGTCCATCCCGGCTATACTGCTGACCTCGCTGCCGCGTA
TCTTGCCCATGCAGGCCTTGCAGAACGTGGTCTTCACCACCTGGAACGTCCGCGGCGTTGAGGTCGCGTTGTCATCCAGCATCGGAGCGTCGCGAACTGT
CATGCAGCGACGACAGGCAACCTCACCACAAAGGCGACAGTGCTGGCGGCGCCGCGTAGTGGAAAACTTGCGGTCGCACACAGCGCAGTTCGTGCGCGCC
TTCTTGGGCGCCCAACTGCTGCGGTCCAGGATGCCGTAGGTCGTGATCTTCTTCGAGTCGGCGTACAGCGCCATGGAGCTCAGCGTGGTCATGAGCTTCT
TGAACGTCGCGACCGACGAGGACGTCGAGCCCTTGAGCATGTCGATCTCGTTGGTCATGAAGATCTGGGTGGTGTCCGCGCTGTCGGTCGTGGGGCGCAC
GATGGTGACGGTGTGCGCGTGAACTCGCCTGGTCTTGAGCTTCTCCGGCATTGGCGGACACTCCTCGAGCTGCAGCGGCAGCGCGATGCGCACGCCGACG
TCTCGGTCCTGCAGGTCCTTGGTGAAGACGAGGTACTCGAGGAAGCACATATCGCGCTTGCGCGCGAGCTTGGACGGGTCCAGACAGAGCCACTTCATGC
CGAGATACAGATGTGCCTTGCTCGATTCTTTCGTGTGGATGTTGCACAGCACGGCGGCATCCACGGCGTAGCCGAACATGAACTGGTTGACGGCGAAGAG
CTCCTGCGCCGTAGTCGAGTAGTAGAAGTCGAGGAAGTTGCGGTAGTCACCGTCCACACGCCCGAAAATGCGCGAGGACTCGACGGCCCGGGACGGGTCC
ACCTCGCGGATGGCGGTGAGGTGCTCGACGCTGCCCACCGCGCTCCAGCGGGAGCCGTAGTCCGGGCGCGCGCCCATGGCCTCGTGCAGGTTGTACTCGG
CCAGCGCGTTCTTCGTGATGATCTCCACACGCTGCTCGTAGACCTCGATCTCCGCCGGCGTGAGCTTCACGGGCGCGAAGTAGCCGTCGGGCAGCGGGAA
CTTGACGTTGCTCGAGTTCATCGTTCCTCCTGTTGGCCGCGCTGGGACTCGGGCGAGACGTACGCAGGCTCCTGTGGCCCAGAGCGGTCCTTTTGCAGTG
TGTCGGCGCGCACGCGCATATCGCAGCCCACGCTCTCGATGCTCTCGATGCTGTGCGCGGTTGTGGCTGGCCCGTCCACCGTGTGCAATGCCGCAATGCT
GCAAAGTGCTGTCGGCGTCGCTGCAACTCGCATCGCCCTCGCACGCGCCTTTCGCCGCGCTGGGCGCTTTATGCAGGCGTCGAGCGGACAGACATCCGGT
TTCCGTGGCGCGCCTAAGAGCAGGGCGGACGGACGTCGGCCAAGCCCGGTGATCGACGCCCATGAGGCAGCTTGGCCGTCTTGAGGCTGGCAGGACTTCC
GTCCAGACGTGTGGCCGATGTCGGTGGCTGCACGGATGGGCAATCAACCGGCGCCGTCACTCACGCGCTGCCGTGCTCGGAGCACGGTGTGGTCTTGTCA
TGGCCCTGCTACAGTGTATGTAAGGTTTCCTGGCCAAAAGCACCACGGAGGTCCGACGCTAGGTATCGATAGGTATGCATTCTTTCGGGGCGATCACGCC
CAGATGCCCGTGTCAATACCCTGGGCGTGAGTGCCCCGCGTTTCAAATAGCTGCCTTACGACATCCGGAATGGGAGTTGTGGCCGCAGAGCGCATTGACA
ACAGCTACACGCGCGAGCCCAATTTTTTCATGCCCCCCGCGGTGCTCCGTCTTGCTCGAAGCAAGACGGGGCCAAGGCAGACGCGCCTCGAGGCTTGAAC
CCGGCTCATGACATGCTAAGGTGGCTTCCTGTCACTCATTGCCGGCTTGCCGTGTTGATGCAGGGTGAGGCACTCAAGAAGTGATCGGTCGGTCTGGATC
TGAACGCGGCAGTTGCTGACAAGCCTGGGATCGGGACGCAAGGAATGCGTTCCTGAGCGGAGACCACCAGGAAGGACCACAAGGCTCCGTATCACAACGC
ACGATTGCCGAAGCAGGCGATGGTGATGGCGAAGCTCGTCCTACCTAGCGTGTCGTGGCCATCTAAAGTCCGCGCGGAAACCGCATCTAGACTTGCTGCA
ACGCTCGACTCACCTTGATATGATTGAAGTGCCATGCTGCCCACGAGCAAGTGTCGGTCCCTCCTCTTCATCGTGTTCTCATCGTTTTGTGTTCCGCTCA
TCTTTTACGGAGCTCCAGCCACGGCCACAAACTCCAGCACAAAACACGGTCCACCAGACTGTGTATCGCCAAATGCTTAGTAATTCGTGCACCGCACCAA
GGCGAGACCTTGATGGCGCTCGCCGCCACACCACAAGAGCATGGGTGCCTCTCTCTTCTCTATGCGAGTGCCGAGGCCGCGAAAAAATCGAGCGCAGCGC
TTATCTATCGTGCCAGCGCGACGCAAACGTGATGACTGACAACACTGGCAAGTTGCCAAGCAACATCCCGAGCCGGCAGCAACCAGGAACCAGGGACGTG
AAATACAATACTGTAAATACTGTCATGCAAAAGTCCTCACCCCGCCACGGATATCTGTCCCCCAGCTTGGCGGTCTACGGAAGCCAACGGCTTCGGAAGC
GCGGCCCGATCTGTAGGAAGTCTGACCGCACGCCATTGCCTTCGTGCACGCAGGCCTACCGGGACCTGGATCCTGCCTCGCGTTGGTGGTCTCGGTCGCT
CCGGCTAAGTCACGACAGGCATGCTATCACGTCGCTTCTGAAACACATCGCGGCGTAGTGTCCCCAGCTGGCCGGCACACAACCGTCTCTCGGATCGAGA
GTCTCGGTGCAGGTGTACATGTACCTCTCGGAGTGGCTGCATCTCGCACAGTTTCGTATTTTCCACCAACATGGTGCTGCCCTCGAGACGCCGCACCATA
TCTCGGTACGCTGCAGCTGCTGACTCAGCGGTCATGGGCTCTGATAACTTACTAACGCTGCTGGTTAATGCTATCTCGCTCCGACAGGAACGACGCCAAG
ACATTTCCGCTGCCCGATGGCTTCTTCCCAGAGGTGAAGCTCACGGACGAACAGGTCCGCAGCTACGAGCAGCAGGTCCAGAAAATTGTCCACAATGCGC
TGGCGGAGTACGACCGACACGAGGCCAAGGGGGCCTACCCGATCTACTCCGAACCGTGGGTGTCCGTAGGAAGAGAAGGCCCGCTCACCGCCATTCGACA
GGAGATACCCGAAGGCCTTTCCAAGAGCCAATTCCGCCTCTGTGGCCGCATTCACGGCAACTACCGAAATTTCATGGACTTCCATTACGCCGAAACCTCG
CGGGAGCTCTTCGAGTGGAACCAGTTCATGTACGGCTACGTGGTCGACGCGGTGGTACTCAAGAACATCCACACGAGGAGCTCCGGAAAAGCGCACGAGT
ACTTGGGGATCAAGTGGACGTGTCTGCAGCCGTCGCCCTTTGGCCGCAAGCGAGATAACTGCTTCCTCGAGTACCTGGCCTACACGAAGGACGAGCTGGG
CCGCGACGTGGGCGTTCGCGTGACGTTCCCCGTGCAGATCAAAGAATGCCCCGATCTGTACAGCAGTTTGAGGGTGAAGCGGGTCAAGACGCACACCGTC
ACCATCGTCCGTCCTGCCGCGTCGTCTTCGGACGCAACCCAGCTCTTCATCATGAGCAAGAACGACTTCGCGGGGTCGTCGGTGAGCGCGCGGAATTTCC
GCAAGTTCATGCGCATCTGCAACAACCTCCCGTACCAGGTCGACTCCAAGTACATTTTGAGGCAGGGCTTGATGTGCAAGACGAACTGGATGCCCGACGA
CTTGCGCCAGGCGTGTACTAGCTGCCAGCTCCCGTTCAACGCGGCGACACGCCGTCGGTCGCATTGTCGGCTTTGCGGGGACATCTTCTGCCACCACTGC
GTGATTTCTCGCAATGTCCCCCGCAACCACAGAGCCGACTCTACGTCGCGCGTCTTCAAGGTTGCGAAGACAAATTTCTGCAAAGCGTGTGTGTCATCAG
TTCGCCGCTCGTCGATGCCGGGGTTTGCTCGGGCGTCGTCAGCCACACACGCCAGTAGCGTTGAAAAGCTGAGCTCTGAAAACACCGGCTGCACGCTGCG
AAAAGCTCACAGCAACACGGCCAATCCACGCTGGTGGGATGACATTTCATGGTCCGAGTCTGACTGGTCGGAGACGGACTCTGATGACAAGGCCTCACTC
AACGCCTCGGGTATCTCAATGGGGTCTTTGCTTGCAAGTTCGCTGTCCTCATCGCAATCTTCGTGGAAGTCTCGCGCCGAGAACACCTTGGACAAGGATG
AGTTGCCCTTTGTGAGTACGTTAGATGTTATCGACGACGATGTGGCGGTGCTGGGCGAAAATTCCCAGCAGCCCAAGTCTAGGTTGCGGAAGACGCTATC
TATGTCCGGCCAGTATTCGATGAGCCGAAGACACTCGGGTCGGAAGCAGCAGGCAGACCCGCTGGATATCGCCGAAGTCATCGACACAACGGACATGATG
CCAATGTCAGAATATCGACGCCAATCCCGGGCAACCACCGGGGCTGCGCTACCCCCGCGGAAGTACAGCAAACACCGCAGCGATCAGGAGTCGTTGTTGA
GCTCGAGTGACCCTCGGGAGGAGCCTACCAACCGGTTCCAATCCTCTCGCTCGATCAGTCAATGCCTGGCGGAGCAGGAGGAGCTTTTGCGTTGTATGCT
CAGCGTCAGCCGAGTGCACTCGAACTCCAACGTTCGGTCCAAGGGAAGACCCACAGGAGAGCGGATGAACTTCGCGGCGACGATGCCCGTGCCGCGCCCC
GCAGTTCGACTTTATGATCTTTAAACCAT