Description :
From Genome Similarity Track
Location :
Scaffold_101:198043- 199149
Sequence
1106 bases(100 bases per row)
AGTTTACATATGGGGATTTGCACAAAGTCCGAAGGCGGCATCGTTTAAATATTAAATACTTTTTCATAATGCATGTTGTTATTGATATTTGAATACTACA
GTAAACGGAGGGTAGGGTGCTTAGCGTACACGTAAGCATGCGTGTTTCCGAGGACATGGTTTAAGTATACTAAATACTCTGTACTCAGTAGGATCTGTGT
GTTACACTGACTAAAATGAAATTTCATTTTTCTTACTGCAAAAATATTAGCATTAATAAGTTATCTGAGTGGGTTTCTGGTATTGCTAAATCGTACACGT
TACATGTACAGCAGTAGCCGGTCGTGTAGACTGGCCGTAAGAACAAAACTGTGCTTATAAACGTTGTCACTTGATCCACAAAGATATATAGTGTTAGATT
GACGTGTGAACAAAAAGAAGTTATATGTGCTGATGACAATTACTACTGTAAGCGAATTGAACTTGACCATTGTTTCCTTAGCGTTTTTTTAGACAACAAA
ATTCTGATACTTCTTAATAGGTAGACGCGTTGCCGACAAGGGCGTAAAATAAGGTTTTATATGCAGTGGTAAGATAACAGCACAACATGAGAGGTGTCAA
TTTTGGTTATTATAAGAAGGCCCGTAAAGAAACGTTAATCAACTTAGAGCCTAATATTTTGGAATCATCAATTAAGTATCAAATAAAAATACCGCCGTCA
ACAACAACAACAGCAAGGCGTCTTGCGACGCATGGTTATATTCAAAGGCTATAAGCATAACAGGCACAGATTGAGTGTCTAATGACTAATTCTGAATCAG
CACAAAATGAACACACTTCAAGGCATAAAAAAATGCTACAGCTTGAATATTTTTATTAAATATTCAAACTGTAACAATGTCCATTTTCTTTCAAAGTAGC
GAGTTTGGTTTGCGAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN