Description :
From Genome Similarity Track
Location :
Scaffold_27:198001- 200729
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009711Similar to RBOHB: Respiratory burst oxidase homolog protein B (Solanum tuberosum)

Sequence
2728 bases(100 bases per row)
ACTAGAAGGGACAAAACTCAGGCGAGGATGTGTAGGATTGGAGCATTCTGGAGGTCCAAACGACCAACATGTTATGTTATAAGGTGAGGTTTTATTTAGC
TGACCTACAAAACGACGAACATGTAAAGTTTGTCTCACTGGCCCGTGTAAACTCTACAAAGCTGCAAACTCCATCCAAACATTGTACTGTAATACATGCT
CAGTATAAGTACTGCTCCTCCACATCCACAACACACTTCTCTTGCGTCGTTCATTCTAAGCAAACGCAACAACATACATTCCAGTAGGATGCGATTTTTG
AACCTGAGAATTGAGAGGTGTACGATCAGGAAACGATCTCGAGTATAACCACTTGCCATCTCTCAAAAGTTGAGCACCTGCAGCAGCAGCAGCTTTTCTC
TTTCTAGAAATCCAAACAGGGCTCAGCTGCGATTGCTTTGAAATTTAAAACAATAAGATACGCAACGGAGACCCACCTTGGGTTCATCCACCCAACCGTT
TTGAGGGACTCTGTTGCAGAGTGCGCTCGAAAGAACGCAAGGCAACATTCCAGAAACCTGGTGGATCGCTTGCGTTTTTACGCAGCTACAGGATGCGTTT
TCCACCAACTGGTGAGCCTCGTTCGGCCATCAGATCTGTCGATGGCTCCTGTCCGTTTTGTAACACTCATGGAGGCAGCATGTCCTCTTATTGGTCGAAG
CCAGACGCTTCAAGCGTCCTTCATCCAATGGGATCACCAGAATGTTTGTGTAACGGAAGCTAAATGCCCCTTTTATTTTTTTCTGTGGATCTGGTCACAG
GGATACAGTCAGTTACTGGAGACTGGTATCCATGCCAAGCTAACCACACGCGATACCCCACGATACCTTATCTGCATGTGCACTGGTGCTTTCCTGCAAA
GCGGAACCGTAAAACTGAATAACCCTGTGCAAGTCCATCGCACTGAAGACCGCTCTCTAGCTGCCTAGAAGGAAAAAGTATCTGCCTTTAGTCCCAACTG
ACCTTCCCCCTGCGCTCGGGGATCCCACTGCATCACCGTGAACGTTGGGATGACACAGAGTTTCCAGCTCACCAGATGCCTATGGGGTTGTAGATACTGA
GTGTACAATACATCCTCGTCCTTTTCGCTAGAGCCGCTCTCCACTCCATTCATCTGACCTGCCTCAACCACACCAATCCGAGCAGCTACAGCTAAAGCCT
CATTCCGACATTTTCTCTCAACTATTCAAGTGCTCGCGAGAAAACTACGAACTCAAGCCTCGCAAAGATGGCACCAGGAACCGCGGCACTGACACCTAAT
CCTATGGGCGAATACGCTGTCATCAAGACCCCAGACGTCGATGCAACCACCAAGCCTTCCATCGCCCACAGCGAACGCTTCGGACCATCCAAATGGGCTG
TAAAATACTGGTACCTCGGCAGCTTGGCTCAGTTCTTGATCCTCGCATCGGTCGTGGTGTACGTCTATGGCCAGATCGCGTACTTCGCTCCGTCCTACAG
CAACTCGGTCAGTAAGACGATCGGGTCCTGGTGGGGTGTGCCAAGAGCCAACACTGGTAAAGGCTCTTCGAAAGGCCACAGTGAGATGACTCGTCCAACG
TACTTCTTCCTCTTCGCTCTTCTACCGCTTTTCGTGTCGCTGTTCCTGATCGAGCTTCGTCGTCACTACAACGTCCGTCAAATCTCGTCCCGTTTCGTGC
TGAAGTTCGCGTTGATCATGCGCCGCAAGCCACGCATCTTTGGTTGGATCTCGTTCGTCAGCTTCGGTGAGCTGTTGTTCCTCGGTGTCTTGATTGGTGG
TAACGTCTTGGTGTTCTACTACTACTACACCGCGCGATACAACCGAATCAGCAGTGCATCAAAGAGCAGAGGCACGTCCATTTCCTTCAATACCTATATG
GAGATGATCGGTCTCACGCTGGGCTTTAGCTGCATCTTCAACATGGCGTTCCTGTTCATCCCAGCGACCCGCAACGCCGTCTGGATGGAGTTCATGAACA
TCTCGTACGCGAACGGAGTCAAGTACCACCGCTGGATCGGCGTGTTGACGGTGCTCACGGCGTTCTTCCATTGTGTCGGCTACTACATCTCGTGGGTCCG
TCAAGGAACGTGGAGCGCGCAAGCGCTTCCATGTTTTGACTGCCCTCTCAACGAACGCAAGGGCGTAAAAGTGTGGATGAACGTGTTCGGTGAGATCGCC
CTTTTAGCGTTCCTTATCATCGGCCTCACCTCGATCCCGTGGGTACGCCGCAAATTTTACAACGCCTTCTACTACTTCCACCACCTCTTCATTGTCGGCG
TGGTGTTTGCCGTGCTTCACTGGAACCCAATCATCCTCTGGATCTTCCCAACGTTCCTGCTCTACATCATCAGCCGCAGTCTCTCGAGCGCCAACTCGTT
CACGCCAGTCCAGATCAAGGAGTTTACGACGCTGGACAACGACATCGTCAAGATCGTGATCTCGCGCTCGGCAGCCCGCGCAGGTGACTACAAGGTCGGC
CAGTTCGTGTACCTCAACGTGCCTTCGATCTCGAAGCTCCAGTGGCACGCGTTCACGATCGGTTCTTCGCCTCGCGCCAACGCCACGACGTTGACGATCT
TGCTCAAGTCGCTCGGTGATTGGACGAAACAACTTGTGCACTACTCGGAGGATTGCAAAAAGAACAATGAGCTCCCTACGATCTTCATGGATGGCTACTA
CGGTGCATCACTGGAAATGTACGAAGAG