Description :
From Genome Similarity Track
Location :
Scaffold_1576:198- 3276
Sequence
3078 bases(100 bases per row)
GCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACC
TTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGC
AATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCT
GGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGCGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGAT
CTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTG
GGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTAGCCGTTCGATCG
TTGGGCGCAGTGAGACAGATTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGA
CACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCG
CAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAACACGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACATGT
TCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATC
TGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGA
TCTGCCCAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCC
GACTTGACTTTGCTGATCCATGTTCTCGCTGGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGA
TCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGAAGTC
GTCTCCCTCCACGGATTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAA
CGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGAAGGTGTCGGAAGAGCCGGTGGCCGTCTGGTCCACTGGCGAGTCAGAATTTGTGGGCG
ATTACCTTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGTTCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGA
TCCCGAGTCTTCATGTTCACAGGGACTTCCTCTCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAACGTCATGCGTCGGGGATC
GGACGACGTGTCGGATCCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTT
TCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGTGGATACTATGAGATCCTAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACGCCAG
CTACGATGCCCGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGACGTTTTCGTTGGTGCTCTCACCGGTTCCTTGGATCTTCG
ATCTGTCGTGGATTCAGGATCTGCATGACAGGATCGTGATGTAGGAAGTCGCGTAAAGCTTGGTGGTGATACACAAACTCGAGATCCTTGTCGGACCAGC
TTGACTGGATTCAGCTTGGTCTTCTTCCGACTCTGAAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGC
GAGCTTGGGTTTAGGTACGGTGTTGGCTTAGCCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTG
CGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTT
CCTCCCAAACCTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACT
TGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCATTATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATT
GCCGGATCCAGCTTACCAACTGCACCCAGGCACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTC
GGTAGGGCGGGATCTTGCTCTCTCGGTAGCTTCCGAGGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGG
AAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATTCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCC
TTGCGGGTGTGTTCCCTTGCCTTTGTAGTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG