Description :
From Genome Similarity Track
Location :
Scaffold_728:198- 2013
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_728-abinit-gene-0.20RNA polymerase-associated protein CTR9

Sequence
1815 bases(100 bases per row)
GCGCCAACCACCGCCCGCCAAaTTCAAAGCGCAGCTGCAGCGCCGCATCTTGTCCGGGCCATGCGCCACCCACGGGGCTCgCAGCCAATCAGCAGCGCGC
GGGCCACCAAAACCCACCCCTCGCCCcacACcACGATGCCAACTTGGCGGGAACGCGGGAGTTCACCCCGGCCAAGTGGGTTAACTTGGCGCCAACATGA
ATCGACCAGCGGGTTTTGGGgACGCGGGCGGGTGGGTCGAGTCGGTTGGCGGGATCGAATCATGCGACCAgCcGAATCAATCCGGgaCGATTTCATCATC
AGTGATCgCTTGAGAAGGCAGCATCGGCGACGCCGATTGGGCCaGGAGgTCGCATGGCcACATGACGCAATGCTCACCACCGGTACGAGACGATCCGAGA
TCACGATCGAGTTCCGAGTGTTGTGTCTGGTTGTCTaggcACGACTAGCTTAGTATTtGGTTAATGAAAAAAATGCCGTACGTATCCATGGCGTCCTAGC
GCGTGGATCTACTCCTCGTCCGAGGAAGAGCCGAACAGCTCGTCCTTCTCGGCTTGGCGAGCGCTATCTGCACCTGCACTCTCTGTCTTGGCGCCCTGCT
CATCGTCTTCATCGTCGCTGTTAACaGTCTTGCCACCAGACGACGCGGACTTTGACTTGGTCGACGGGATGTCGACTTCGTCGTCGCTTGAGTCAGAGCC
AAACAGATCAGCAGCaTTGGCACTGGgATCATCATCTCCGTCTTCTTCTTCTTCATCGTCCGAGCCGCGCTCACGCTTCTGTCGCTTATCAGCAAGCTTC
TTAAGCTTCTTATTACGGTTCTTCATGTCATCGATTGACATGCCAGTGTCACCATCCTGGTCGTCATCACTGCCATCATCGATGAAGCCTTCGTCGTCCT
CGCTCTTCTTTCGCTTACGGCCGCCAACTGCACCCTTCTTCTTGgTTGCCTTCTTCTCTTCTTCCTCCTTCTCaCGCTGCTTCCAGCCTTGGCTGAGCTG
GCGCAATCGCTCTTCTTGCTTCTGCAAAACaTCAGCACGACGGCGACGAAGATCCTCCTCACGCACGCGCTCTTCCTCCTTCTCGCGGGCAATACGGTCC
TCGTACTCCTGGAGCATCTTACGACGCGCCTCGTTCTCCAGACGGAGCTTCTCTTCTTTTtGGCGTTCGAACTCCAAGTGGTAGCTAGCCTTTGTGAGCG
TGTCGGCACAGAACTTCTCGTGCtCcGATGCCTTCTCTTTGTCGAACGGAATACCACCTCCTTTCTTGttctGACCAGCACCTTCGGCATGATTCAGCAG
GCTCTGGAATGTTTGTTGAGCACGCTTCAGGTCTGAAATTGCTCTTTGGACATCGGCCATCGTTCGCTGTCCAACAGAGCCGCCAGGTCGTGACCCTGGT
GGAGCAGACTCTTGGCCAAGGGTAGCAACAGCGTAGTCTTCTTGTGCTAGGGCGAGGTTATACTGCAATCGGAGGTCATTCGGTCGCAAGTGGAGACCGC
GGGCCAATGTGGTGATACACTTCGGGTAGTTTTTGgAcTcGTAGTATGCCTTGGCAaGGTATAGCAACACTTCGAGATCCTGGCCATTGTAGCACTtGGT
GAGACACACTGAGTATAGCTGGATAGCCTCAGCATAGCGCTCTTCAGCGACGTAGATATGAGCCAAATTGACCCAAGCGTCTGGCATATCGGGGCTTGCC
TCACGAACTTGAGAAAAGATTAGCTTTGCCAGTTCGAAGTTCCCCTTTtCTGCCATCATGATACCGAGACCGTTCGCTGCGTAGAGGTTTCGAGGCTGTA
GCTGCATCGTCTTCT