Description :
From Genome Similarity Track
Location :
Scaffold_2147:198- 1283
Transcript NameFunction/comments
Phymu_g13916Transposable element Tc3 transposase putative

Sequence
1085 bases(100 bases per row)
TACACTCGATGACAGGTTCGATCGGCCACCTACGTTTTGATCCACAACTCTATCAATTTTTTGGAGTTCGGACCTGCTATTTAAATATGTTTGCGCTGTG
ATCAGTAGAAATACGCTTCTTGAGCTAACGCACGCGATTTCGCTGCCCTTCTAGTGGCTACCATACAACATAGTGGTTTTGGTCATGCGTCAAATTATAT
CGGCCACCCCATTCCATATTAAAACCAAGTGTAACAGAATGATTGTAATTTAGTAATGATTTTTGTTCCCTTTCCGGTAAACTACTTCAACGCATCGGCG
TGGTATCAAGCCCTTGGGATAGAATTTCATGCCTCAAAGAGCACGGCTCTTTACTGAGCCACGCTATCGAATTGTTTTCCATTAGGATACACTCTTCTAC
TCATGATAGACCACAAGTTTTCTAGAGGATTCAGATCTGGGGACTTTGGCGGCCAATCTAGCACCTTCACTTCCTGCTCTGTGAAAAAACCCTTGGTGCG
TTGGGAGGTGAGGATGCTTGCTGATAAATAAAATCAATGCCGTAGTTGAGGTGGGCGAAGGGGAGGAGGTTCTCAGACATAGTGTAAACATAGTCGTCTG
AGTTTTGCCTTTCTgtgagcaccaccagcggtGACTTGCCGCACGAGCTGAACGCCGCCCATATCATAACCGATCCACCGCCAGCCTGCCTCCTCTTGGT
CTGGCGCGGAGGCTTTCTTAGATCCCGCCAGTAGTGCTGAAAGTCAAGGTTCCACTTCTTCTCATCAGAGAAGATGATTGAGTAACAGACGGACCCAGCG
TCTTTCTGCACGAGCATGGCTCTGCCCCACGCCTTGCGTACCATGGCCTCGGGCTTGAGCGGCAACGAGTTGTCCATCTTGGTGTACACCAACCAGTCCA
CCCTCGCCAGGGTGCACTGGATGGTGCGCACCGAGACGGAAAACTGCATCTGggtcttgatcttggccgcTGAGAGCTCGCTGTTTGCCGCTGTACGGAC
GAGCCTTCGGTTCTCGCGGTCGGTGAGGGTGGGGGGAGGGCCTGAGCACTTGTGAGGCGGGGGAGATGATGCGGCTGACGGTGTc