Description :
From Genome Similarity Track
Location :
Scaffold_105:197947- 202770
Transcript NameFunction/comments
Phyci_238474conserved hypothetical protein
Phyci_238388Hypothetical protein
Phyci_84057conserved hypothetical protein

Sequence
4823 bases(100 bases per row)
TGTTCGGAGTCAAATGGGAGCGCAATCACGTTGTGGCTATCGACTTGTCTGGGAATTCACTCACTGGATCATTCCCTGCCGAGATTGTCCAGCTCCGCTT
CCTCACGACGCTGAAGATGCGCAACAACCCAAACTTGCGCGGCACGTTACCACGCGAGATTTACTCCATGCCTCATCTCAAGTTCTGCTATGTGGACGGC
ACGAAAATTGATCACGCCATGCCGTACAACATCGCGCACTCGTTCCAAATCACGCAGTTGAAGCCTGAAATGGGTAGAGCTGTCGGGTCGGCGATATCCA
CGGTGCGATTCTGCACAGGTGACAGCCATACGAGCAATCTAATTCACTGGATGGCCGACATGACCGAGGCTGAGATGTACATGGTGCACTCGTCGCTTAA
AAAGCTCCACGAAAGCGCTGACCCAATGGCACGCCGCCAAATCAAGTGCACTGCCAGCAACGCCACGGGACCCGAACGCGCCGCTGCTGCCACGAAGCTG
CAGCGCATTTACCGAGCTCGCATCGAACGCACCAAATTCCGCAACTTCTTGCATTCGCTTGTGGAAATGAAGATCGATCCGGCCACAGGGTACACGTACT
ACGTCAACGCTCGAACTGGAGAAGCGACTTGGGAAAAGCCCAAGTTCCTTGGGTCAGACACTGCAATCAAGTCTTCAGTCGAGTCTTCAGCCGAGAATTC
TGGTGATGGTGGTGACATCGCTGGTAACAACGGTCAAGACGCGTGGTCACCCTACGACGACGGCAACGGCAACACGGTAAAGTGTCTTCGACCATCTCTC
CTTTGATCCGGGAAGACTTACCGCCCACTGCGAAACTTGTTCACTTGTGCGAATCACAGTACTACTGGAACAGCGTGACGGGGGAGTCATCTTGGGAGCC
ACCGAGCTTCCTTACTCGCATCTACCAAGAGCTCCGCGAACGTTACGGCACCGACAAGACGGACGAGGAGCGCTTCGAGCTCTTCTTCCAGGACATCGAC
CGCGACGGGACGGGAGAAATCGACCAAGATGAGTTCGCACGCTTGTGCGGCGATCTGGGCATGGCCTTTTCAGCCAAACAGATAAAGGAGGTCTACCGCG
AGCTCGACACCAGCGGCGACGGCCAACTTGATCGCCAGGAAATCATCGCGTGGCTCACTCGAAACTACAAATAACGAACATGAGATAGAGTTGTTCCAAT
AGTCAATAACAAGTCTATTCATCATCACAGAGGAGCTGTAGTAGCTTCTCAGAATCTGCGATCGTGCGCGTCAAACCGATGATCTGATTTCCACTGATCA
GGTAAGTGTCGGTGCAAGCACACTTGACTGTAGGCGACTTCGTGCCATCGAAATCATCGATGCTTTCTGACCGGCGGAAGGTAGCATCGAACTCCACGAT
CACGGAATAGCCGATGGCTTGAATGCTTTTCTCTTCGACGGAGACCACATCCAGGCACTGCTTAAATAATGAGACGTATTTGATGATCCCTTGGTCCCCA
TGGTACGCTCCCCAAAAAGGCATCTCTTCAGGCACCTCAGACTTGATGAAGAAGCTGGCAGAGGTCATAGGTCCAAGCAAATTGACGTCCGGGACAACCA
GGTACACCCCGTCTCGGTTCTTTGCAACGCACTCGACCAGCTCTGTGTTACCCGCTTCATCGATATCGCTGAAGCTGTTTCGTGCCGTGCGCGTCCTGGT
GACAGCACACTGCATCGCCTCGAACCACCGCATCCTTATTGCTTCTGAGCGCGTGACGAACGTCAGCGTTTCATCCTCTTCGCGGTGACCGTCGAATACG
TCGACCTGGAAGCCGAATGCACCGCGGTTCGGCTTTTTCAGACTCCGTCCGAACGCGATCCATTTCCGCGCATTGCATACAACCAGCTTCTTGGGTCGAG
AGGTCCACGTTTGCGTTTGTGCCAGCAAAAACTGCTTCAGCATCGAGGCTTTAGACGGAGAAGTCGCTTTGGCTGCACCATTGCTCGGGGATTCACACAA
CGCAGCTGTAGCGTCCTGCAAAGTGAGCTGGCAAGTAGCCTTCTCGAATTTCAGATGCACCTTGGCCCACTTCGAACGCTTCTGATACGCGCACCCACTA
ACAAAGAATTCGTCTTCCTCGACATCGAATGGTGTCGACTCATCCGACTGCAGGATGTCGATGATAGACTCCGGGAACTTGCTTTGTGACCGGCTCTGGA
ACATGTCACTTGGATGCACAGCCTCATTTCCTCTTGCCAAGTTGTGCGCAGACCCGAAGCCCTCCTTCTCCATCGGCAGCCGTCTAAAAGGCTCTAGCTC
GCGTGAGAGATATTCACTTGCTGATGAAGACGGTCGCGCTAGCGGGAAATCGGCATCGACTTCATCTTCACTAGTGTTGCGCTTTCTCGGGGTTCCGTTG
CGCCCTCCGCCTGTGACAACTTGCAAGCCGAGTAGTGAGTCATCCAGCGCATCCATCTGCTGATAGTGTGTAGCGACTAATGAAGAAGCAAAATCATTCC
AGCCCTTCACATTATTGCAAAACTGGCGAATCAACTCCTGCTGGAGCGTAGGTGAGCTGCAAATCTTTGCGATTTTTACGCCAATAATCGCCAGGTGAGC
GTCGTAAATGTGGCCCAAGCTGTTTGCGTGCAATTTCTGCAAAATAAACTCCAGGATAGAATCGGGCGAGCGGAAGACGCTGCGTAGCAGCGGGTTGTTC
ACGCGCCCGTTTGTCGTCGGACGATTCAGTAGATTCAGGTAGAGCTTCACTAACCGGCAGTGCAAAATACTGGCTTTGGGAAACTTCTCGAAAATATCCA
TCAGAGATGTAGCAAGGTCCAACCGGGACAATCGGCTATCAATGCGATCGTTTGACATCCGAATGACAGCATCCAGCAACTCCACCACGTGCATAACCAG
CAAGGTTGATGCTAGCGGTCGATGATTCACGACTGCCTTTCCGGATCGAGGAGAGTAGCTGAGTGCAGGAGGAGTGATTCCCATATAGAGCGCAGTTCGC
CCGGGTACTACAGCAGGCCGCTTCACAGGCTTGCTCGGACTGTCTTTTCCAGCAACCGAATCCAAGTCCTCGCCATCTTCGGTGTCATCATCATCGGAGT
CGCTGTCGCTGAAGCAATCGCGTGCAGCGAACTCTGATATCGTAGACAGGTGCTGGTGGTAATTGATCGATGCGCATATTGTGTCTAAAACGAGGTGGAT
CGGCGCCACAAACACCTCCAGCTGTTCAGAATCATGCAAACAGAACTCAATAGCATGCCGTAAAGTGTCGATCACGAGAACGCGCGGGATACAGACATCG
TTGACGTAATGGGCATCCAAAAAGCGAAGCTCGGCCATCCCTAGCTCTGCCAATCGCGCAAGAATAGTCGAGTTTTCAACCAAAGCAGCCAGCACCGCAC
ACTTGAGTTTATAGTGCATTGCAGGATCGCTAGGTGCCATCCTTGGGGGAAAGAGCTCGCGTTCAAAAGTCTCGACGCTCTCGAACGAAGCCAACTGGAT
TTTCGTTTGTATATAATAGCGGAAAGTGTTGGGGAATTCATCTTTCAGGATTTTCGTCAAGATCTCAGCACACCCACTTATCCTCGCATGCACAGTTGAC
GTTGTGTTCGTGGTAAACAACGAGGGAGACAATGGCGCCGTCTTGGACGAGAAAAATGAAGACGGTGATACAGAGGGAGGAGATCCACCGAGCGACGACC
GCGGTGACGCAGACGATGTGGACGACACGGTCGACGTAGATGAAACGGCAGACATGGACCTCGCTAGTCGAGTCGGCACTTGCTCCACAATCCGCTCAAC
CAGGCAGCGCACGATCGGAAAATATTCAAACCCTCGACGGATAGAAAGGTGAATCAATCCGTGCAGCAACGATGCAATGTCCGGATTGTACGCATGAGCC
GCAAGGCGCGACAGCAGCCACTCTCCCTCGGAATCTTCATTTTCGTCGCAAATTAGCCTGTGGACCGCTGGAAACGTGACAAAATTCTTAGTGATGCGAC
ACATGTTGGCAACCAAGACGCTGTCCACCTCCACCTCGTCATCCTGTACATTATTTTCTCCATTTTTCACCTTCGGCCACAAAAACCGGAACAATCCGCC
GAAAATCCGCTTCCACTCGTTCGCCGTCAAGTCTTCCAGTCGCAGCAAATATCCACGCGTAACTGGATCCTCGAGCAGCTCCTCGTCTTCGTCGCCATTG
ACACTGAATTCGGAAATGCTGCTCCCAGAGCTTTCGAACCTCATACTGGCACGTAACCGCTGGATTCTCGCCATTTTCCGAGTCGATGCGTTGCTCCTAA
AGTCCATCATCGTCAGCATGTTGGTCGGAGCTGTAGAGGACGACACTGCCAGCCCCTCCAGACTCACACCCGGTGCTGATGCGGATTTTCGGTCCTGGAT
TGCGTCAGGTTGCCCATTTTCCGTTGGATTTTCTCCATTTTCCGGTTTATCCGCATTTTCCTCCGCTGGGTCTTGCTTCGGTTCTCCGTACCAGGCCATG
GCTTTTAGGTAAAATCTGAGGATAATCTCCGTGGCCACGTAGCATTGGCGGTATTTGTCCGGGTGGTGGTTACGTGAATTTGGGCCTGTTGCCTCCTCGT
CGACCCCATTTTCACTTAAATCATGGTGCTCGTCGCTGAACGACGTGGCGTAGGCAAAGACCTGCTTGATGGACTCGGGCTCCAACAGGAGCTTTTGCAC
GGGCGAGAAGTGGCCCCTTTCTCTCCGTTGTACCGTGGTTAGCACTGTGTCCACGTCGTAGCAGCTGCAGAAGACGTTGTCGAGCGCCGGGGCTTGGCGC
AGCGCCTCGGCGTTGTGGAGCGC