Description :
From Genome Similarity Track
Location :
Scaffold_79:19794- 21430
Transcript NameFunction/comments
Phymu_g3659hypothetical protein PHYSODRAFT_554223

Sequence
1636 bases(100 bases per row)
GCCGTCGCTGGCCGCAGCGGTGACAAGGAAGAACGTCAGCACGAGCACGGCGATCTTCATGATGGACACGAAACTCGTGGTAGTCTGCACGAACTTCGAG
TGGTGCGGCGACTGGATCTCCAGGTAGAAGAAAAACAGCACGTTGAGCGCAAGGATGATAGAAACCTGCACTGTACCAGACATGCTGGCACAGCCAGTAA
CCACACCGGTCGTTAGCGCGAGCATCATCTTGGCAGCGAAGAAGTAGCGGTTCTTGAACTTGTACTCCTCGTAGAGAGGACCATAACGCATGTTCAcggt
cttcttcaagtgctgCACGGTACCAACATCACTCAGCTCGGCttcgtgcttcttgatgaccACATAGCCGTACACGAGGATaccagcagccaagaagatA
ATAGCAGCGATAGCAAGCAGACACTTCGGGTCCGTGATGCTCTCGTACTTGTTCGAATAGTAAATTTGGAACGTAGCCGTCACACCAATAGTGTACTGCG
AAAGGATAGCCACGAGAACCTCCAGACCGATCATCTtgtcgaagaacttggccagGTACTCCTCACGGGGCATCATGAGGCCGGACAGGAGGTAGCCGAT
GCCAAAAAGACCCACAACACTCGCCATGACACAGAAAACACCAGCCAGAGTCACGATGAACAGCATGTCTTCCTCGATGTTCAGTTGGCGGGAGTACTTG
GCGATGCCAGTAAGCTggtccgagctgctgctggagctggaactgccgCTCGTACTTGAGCTCGAAAGACGACGACCagaggtgctgctgctacttccag
agctgctgctgccacttccagagctgctgctgtctgtggATGAATCGTTGAGCTTTCCAAACGGGAGGAACGTGAAAGCTGCAGGGGCCATGGCTTTACC
AAACTGCGCCAGGGCCGACGACTTGCCgtcaagctgaagctggttcACTAGCACGCCAAACTGGCAGATCTCGACCGTCGTGATGGCCATCGTAGAgcca
gcagctgcgagcGACGCGCCAGCAGAGCTGACTCCACCCACTGCAGTACTGGCAATGGCAGCGATACCAGTGATCGCAACAGTCACACCGGCAACACTCT
TGGACGTAGCAGCCACCACTGTACCGGTTGTGGTGGTGTTATCCTTGGTAATCACACCATCCTCCTCATTCTGAgcacgttgctgcttcttggcagcatc
CGCCACGCTTCCTGAGCTGTCACTGTCAATCAGCATAGCCGAGCACGtgcaggaagagaaggagctctCGGATGTGTACGTGCACTGCTCGGAGTCCGAC
ATAGTAGAGTTCGAGAGGAACGTCGACACTGTGGACGAacgctcctccagcgccgcgatTACGTCGCTCGAAAGGAACGACTCGATGCTCAAACCATCgt
acacggacgacgagatgccGTTGCTCCCTCCGTACACCCAGGCGCTGTTCGTGCAGGCTGGGAAcgagcagatggagacgcacGTGGAGCCAGAAGTGGA
TCCCACTGAGCCGCTGTAAATCACACAGCTGGAGGCCGAAACAGCCGAGGCCACGTCAATCCCGGAGCCACCGCACGTCAGGCCGAGCGTGTCCCACTTG
GAGTAGAACGTGCTGTCACACGTTAGGACGTCCGAG