Description :
From Genome Similarity Track
Location :
scaffold_10:1979- 4766
Transcript NameFunction/comments
g631.t1 hypothetical protein PHYSODRAFT_505374

Sequence
2787 bases(100 bases per row)
CATTGTCGCCATTTCTTGGAACTCCGATGCCGGCACGGTGGGAAGCCGCACAGGCGGGTCTCCGCGTGTTCTTAGAGGAGGACGGTGAATATGTACAGTT
CTTGGAGGGTTTAGTTCTGGACCTAGCGTGTAAGCTGCGCTTTAAGTGTCGACAGCAGGGTGGATCTCTCGTGGAGACTGTCGCATTCGATCGGTTTGTG
GAGGCTGCAGAGCAGCTTCGGTACCTTCATACGTTCTTCCAGGCGAAATTGAAGCTGATTGCGGAGGCCTCAGTGGGTGGAGATGGTAGATCAGCTGATG
AAAAGTGCAGCAGCGTCGTGGGGATTCTCGCGGACATGCTGAGCGTCCTCCGTGTCGTGTACAAGCAGCTTTTTTGCAGAAGCGAAGCTACGCAGGCAGT
ATTGGAAGCAGCGTTAACGAGGGAATCAGAAGACAGGGACGTGATGGAAAGATATTTGACGATGCAGCAACTCACTCCTGAGAAGCTAGTTGACCGGCCG
TTAAAGCGGTTTGATGCTTTGGTGGAATTTGTAGAAGCGCTGGGCAATACTTTTTCAGAGGACGGTAGAGATGGATCCACGAGTAATGGCAGCAATGCAG
TTACTGAAGCGAAGGTCAGTTTTGCTCCCCAGCTGATGCATATCGCCCAGGAGAACAGGCACTTCATTTATCTCGCCAAGGCTGACGTTCAAGCAGAAAA
CGAGCTGATTGCACTTCAAACCAGATTCGACGGTGACGGGGCTGAGGCTTTGACTGATTTATCCGATAACAAGCTACTTCTTCACGGAGAAGTTTTTCTT
TCACAAAGGAGCCAAAGTGATCACTCCGCCGCGCTCGATGAGCCAGAAAGGATTTACGCGCATTGCTTTCAGGACGGGACTTTAGTGTGCAGCAAACGGC
AGAAATCTGAAGCAGGGGAAAAGTTCACGATTCTGCGTTGTCTGCATCTCAAACAGGACGCTGCATTTCTCGAGCACATTCCAACCAGCGTGCCCATTCT
TGGGTCTTCTGATGAAGCTCGTGCTTTGGCATTGATTTTGCAAGACGTAACGCTTGTTTTTGCCTGGAATGACGCTACGGAGAGTCAGCGGTGGGCTGAC
GCCATAGGAGGGTTTTTGGAAATGAATGGGTCGCGTCTCGAAGTACTTCGCCAAGGCCGAGCGATCAGCAACATCCCTGTATCCGAGGAGATTACAACGC
AACTTGTGGAAGCAGATATTATCCCGACAGAGTTTCCGTCCTTTTACGACGACCATCTTCCTGGAGTTTTCTGGATGGCACCCGGCAAGGATTTAAACCC
AAGTACGACCCCTTGGGAGTTGGTTGAAATTGTTTTTTATGCTAGATGGCTACTGGTTTTCGAGCTAAACGGGTGGGGGAGACACTCAGCTTTATGCCAT
TTTGACACCCGTGCACCTGAGATGGAGATTGGCGAGCAACCACGTGGAGATAAAGAGTGGAGCTTGGTTATTTCCAACGGGACTGCAAACCGACTTACTC
TAGTATCGAAAAAGAGGACAAGAATTGATTTCTGGTTTGATCAAGTGTGGAAGGCCGTTGACAGTGCTCAAACTGCAGCTCGACGGGCAGAGAGGGAGAA
AAGAGAGCGGGAAGAGATGGAACAAGAAGAAACCCACACACGTGGTTACACCAGCAGGCGAGGTCGACATACAGGGAAGAAGCGCGCGCTTAAGGTTATA
TCAAGCAGCGGCGAAAGTTCGGCAGATGAAAAACCAAACTCGTGCTTAAATTCAAGTCCTTCAGGGTCCAATATCTCCAAGCCAGATGATAAGACGGACG
AAGAATGTGGTGAGCAGCGCAGGGGCACCTCAGTGACCATTGCGGAAGAAGAACCCACTACTGCAGCCCCGGCGAAGAAGAAATCGCGACGTTTAACTGA
GAGGTCGAAACAGCACTCCACTACGACGTCTGTCCAAGAGGATAGCCCTTCCGCTACCATCGCCTCACCACCAATGAAAACTCCGAAGAGAAGGTGGTTG
AAGAGGAAATCCGAGGACCCAAATGACACTACCCTACTGCCAACTCAGCCTAGTCCAACTATTCCAACCGACGAGTCTACGAGCCAGGTTGATGCTACGC
AGATTCCTGCTAACGAATCCGCTGATGAAGAGCCGAAACCCCAGGAACTGCGGATCATTCTCACCGGTATTGAGCCAACTGCTGCGATCCGAAAGAAAAT
TGATTCGATTGCGGGAGCTATCTACGAAGAAGATATTGAGAAGGCAACGCACATCCTCGCCCCGAAGAACCAACTTAAGCGAACCGTGAAGCTGCTTTGC
GGTATCTCCCGCTGCACTCACATCCTGGACGTGCGATGGCTCGACGAGTCAGCACGTGTGGGTGCTCCTATTTACGAGCGAGCGCACTGCTTGAAGGATG
CGAAGGCCGAGGCAAAATGGCATTTTGACCTCCGGAAAATTATGTACGACGTTACCCTGGAACAGCGGCAGCAGCTCTTCGCCGGACATCAGGTGTTCAT
CACCAACCACAAATCAGTGCTGCCGCCAGTGAAGGACCTAGCGAAGATTGTCGAGGGTGCTGGTGGAATTGCCGTGATGACGGGCAGCGCCGGCCCGAAC
GATGTGGTGATCACAAGTGACGCTGCGCTGACCACGGCCTCAGTTCGCAAGGCGCTGACGCAGGCAAATCCGCAAAAGATTTACTCCGCCGAGCTGGTTT
TGAGTAGTATCCTACAGCAGCACATAGATTTTGACAAGAACCGTCTCGAGCTGCCAGGTGGTGGTGGCAGTCGTCGGCGCAGGTAGA