Description :
From Genome Similarity Track
Location :
contig_34:197864- 201912
Transcript NameFunction/comments
g8162.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g8163.t1hypothetical protein
g8164.t1hypothetical protein

Sequence
4048 bases(100 bases per row)
TGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCG
ACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCGGAGC
CATCTTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATATCACTCGGCTTGGCGGTACTGCTC
GTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGACCCGCG
AGGAACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCGTCATGAA
CGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCAC
GACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCG
GAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGCCG
ACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGC
TGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCA
CTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCG
GGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTGGTCGC
TTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACTTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGG
ATTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCG
TAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGG
TATCCTACCGGTATCCCGCAGCTGCCCGAGGCGCCTTCTTGACAACACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGGTTCCGTTGAACTTGTTG
ATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGTGAAGGCGTAGTCGGGGTCTTGGTCTTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGC
TTGGTCGCTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACAC
TCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGT
AATCCCGTAGCGTAAACAGCGATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACC
GGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGTCTTCTTGACAACACGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACC
ACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCG
CCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAG
ATGGAGGACGAGGACGTGGCGATCTGCCTGTTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAGCTGCGAT
CGCAAGACGTCGTGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACAC
CGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCGACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGC
GGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAGCTACGACTACGGCTACGGCTATGATCGAGTGGCGT
TCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGC
CAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGGACCATCGTGGAACGAGTG
GTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGA
GTGGTCTGTTCCAAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTA
CTGGCTCCAGACGCCTCAGCGATCGGCGAATGCGGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGC
AAGATGGTCGACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGCCAGCAAGGGAAAATGGTCCAGA
AGCCGTTCCCAAGCAACCGTGACAAGCGTCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCACTGGGTGGCAG
CAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTC
ACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCG
AAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCT
GCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACT
CCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGT
GGGACCCCAAGGCTCGCGCCGGGTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGC
GATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCG