Description :
From Genome Similarity Track
Location :
Scaffold_2:19786- 20874
Sequence
1088 bases(100 bases per row)
ATCCTCGATGGAACATGGCTGCTGTGGACAACTAATGTTTTAGGGTAATCGTCAAATGTGTTCAACCCCTTCCATAAGCAATACCAGAATGAATGGCAGG
ACTTTTTTGGTACTGAAAACAACGACATCATGAAGGTTTATCGGATGTGGACTCTTCTTCTCCTTTTCGTTCTCAGCTTTCAAATATGCTTTGCATGCGC
TCAACTGCAGACAGTGATTGTCAGCGCCAGTGTCAACAGAAGACGATCCAGCTTGCACGCATGTCAGCATTGTATTTTGCTTGATGCTGGTGCTATTCAT
GCTAAACTGATTCAGCTGAAGATAAAGGATCGTAAAACTCAAGATGAGAGTGAAGGTTCTATGGCAGAGTTCAAAGTTACCGGGTCAAGCTTCTCTTTTG
CAATATTGCGACAGTCTTGCGAGAGATACCAAATCTGTGAATCTTTGATTTTAACGAATTCTTTCGTGTTAAATCCTCAATCGAACATGCCAGTTGACCA
GCTGGCAGCGTTTACGAATGCACCCGAGCTTCCAACACAGACGAGTCCTGAACAAATTTAAGACGATATGAAAATTGTATGCCTTCTTGGACTCTATACA
AGTGCTCAATGAGAACTTGCCTTAGGCAAAGCAGTGATGGAAAGCATTTTGGAACGTATTACATCTCCGCTGCTTCTCGAATTCGGCTGATATTACATGT
TTTCTCCGCGTCAAAAAGCGTTCAAGACACTCTCCTCTTATGTACTGCATCGTCAGCATGTGGCAGTTTGAGTTTACAAATACCGAGTAAGGAATGTGAA
CACCTGATGCTCGAAAGACCAATGCGTTCTGTTGCGTTTACCAATGGTTTTGAATACTTTCCATACAGATACGAGCTTCTACCAGAAAGTTTCGGCGAAG
TCCAAAAGCAACTCACCGATATCAATCTAAACAAGCAGACATGCATTCAAGCGCAATTCAGCAATATATATTACATCGCAGGGTGGATACATTGTATGGC
AAAAATAACGAACGGTATTGTTGCCATCTTGCAGCGTGAAACGGCGTCGTGTGGACGGGAAGAAATTCAGTATTTGAAAATAATCACC